976 resultados para Queensland fruit fly
Resumo:
The electroantennogram method was used to investigate the number of distinct olfactory receptor neuron types responding to a range of behaviorally active volatile chemicals in gravid Queensland fruit flies, Bactrocera tryoni. Three receptor neuron types were identified. One type responds to methyl butyrate, 2-butanone, farnesene, and carbon dioxide; a second to ethanol; and a third to n-butyric acid and ammonia. The receptor neuron type responding to methyl butyrate, 2-butanone, farnesene, and carbon dioxide consists of three subtypes. The presence of a limited number of receptor neuron types responding to a diverse set of chemicals and the reception of carbon dioxide by a receptor neuron type that responds to other odorants are novel aspects of the peripheral olfactory discrimination process.
Resumo:
Single-unit electrophysiology was used to record the nerve impulses from the carbon dioxide receptors of female Queensland fruit flies, Bactrocera tryoni. The receptors responded to stimulation in a phasic-tonic manner and also had a period of inhibition of the nerve impulses after the end of stimulation, at high stimulus intensities. The cell responding to carbon dioxide was presented with a range of environmental odorants and found to respond to methyl butyrate and 2-butanone. The coding characteristics of the carbon dioxide cell and the ability to detect other odorants are discussed, with particular reference to the known behavior of the fly.
Resumo:
A circulated heated-air treatment at 92% RH to achieve and maintain a minimum fruit core temperature of 44°C for 2 h is shown to disinfest tomatoes against Queensland fruit fly, Bactrocera tryoni (Froggatt) for market access quarantine purposes. The efficacy of the treatment exceeded 99.99%, tested at the 95% confidence level. An estimated 78 439 eggs were used for large-scale trials, as the stage of the pest most tolerant of heat at the treatment temperature.
Resumo:
Queensland fruit fly, Bactrocera (Dacus) tryoni (QFF) is arguably the most costly horticultural insect pest in Australia. Despite this, no model is available to describe its population dynamics and aid in its management. This paper describes a cohort-based model of the population dynamics of the Queensland fruit fly. The model is primarily driven by weather variables, and so can be used at any location where appropriate meteorological data are available. In the model, the life cycle is divided into a number of discreet stages to allow physiological processes to be defined as accurately as possible. Eggs develop and hatch into larvae, which develop into pupae, which emerge as either teneral females or males. Both females and males can enter reproductive and over-wintering life stages, and there is a trapped male life stage to allow model predictions to be compared with trap catch data. All development rates are temperature-dependent. Daily mortality rates are temperature-dependent, but may also be influenced by moisture, density of larvae in fruit, fruit suitability, and age. Eggs, larvae and pupae all have constant establishment mortalities, causing a defined proportion of individuals to die upon entering that life stage. Transfer from one immature stage to the next is based on physiological age. In the adult life stages, transfer between stages may require additional and/or alternative functions. Maximum fecundity is 1400 eggs per female per day, and maximum daily oviposition rate is 80 eggs/female per day. The actual number of eggs laid by a female on any given day is restricted by temperature, density of larva in fruit, suitability of fruit for oviposition, and female activity. Activity of reproductive females and males, which affects reproduction and trapping, decreases with rainfall. Trapping of reproductive males is determined by activity, temperature and the proportion of males in the active population. Limitations of the model are discussed. Despite these, the model provides a useful agreement with trap catch data, and allows key areas for future research to be identified. These critical gaps in the current state of knowledge exist despite over 50 years of research on this key pest. By explicitly attempting to model the population dynamics of this pest we have clearly identified the research areas that must be addressed before progress can be made in developing the model into an operational tool for the management of Queensland fruit fly. (C) 2003 Published by Elsevier B.V.
Resumo:
A remarkably diverse suite of spiroacetals including a novel member of the rare, branched chain class has been identified in the glandular secretions of Bactrocera tryoni, the most destructive horticultural pest in Australia.
Resumo:
Perimeter-baiting of non-crop vegetation using toxic protein baits was developed overseas as a technique for control of melon fly, Zeugodacus (Zeugodacus) cucurbitae (Coquillett) (formerly Bactrocera (Zeugodacus) cucurbitae), and evidence suggests that this technique may also be effective in Australia for control of local fruit fly species in vegetable crops. Using field cage trials and laboratory reared flies, primary data were generated to support this approach by testing fruit flies' feeding response to protein when applied to eight plant species (forage sorghum, grain sorghum, sweet corn, sugarcane, eggplant, cassava, lilly pilly and orange jessamine) and applied at three heights (1, 1.5 and 2 m). When compared across the plants, Queensland fruit fly, Bactrocera tryoni (Froggatt), most commonly fed on protein bait applied to sugarcane and cassava, whereas more cucumber fly, Zeugodacus (Austrodacus) cucumis (French) (formerly Bactrocera (Austrodacus) cucumis), fed on bait applied to sweet corn and forage sorghum. When protein bait was applied at different heights, B. tryoni responded most to bait placed in the upper part of the plants (2 m), whereas Z. cucumis preferred bait placed lower on the plants (1 and 1.5 m). These results have implications for optimal placement of protein bait for best practice control of fruit flies in vegetable crops and suggest that the two species exhibit different foraging behaviours.
Resumo:
Bactrocera tryoni (Froggatt) is Australia's major horticultural insect pest, yet monitoring females remains logistically difficult. We trialled the ‘Ladd trap’ as a potential female surveillance or monitoring tool. This trap design is used to trap and monitor fruit flies in countries other (e.g. USA) than Australia. The Ladd trap consists of a flat yellow panel (a traditional ‘sticky trap’), with a three dimensional red sphere (= a fruit mimic) attached in the middle. We confirmed, in field-cage trials, that the combination of yellow panel and red sphere was more attractive to B. tryoni than the two components in isolation. In a second set of field-cage trials, we showed that it was the red-yellow contrast, rather than the three dimensional effect, which was responsible for the trap's effectiveness, with B. tryoni equally attracted to a Ladd trap as to a two-dimensional yellow panel with a circular red centre. The sex ratio of catches was approximately even in the field-cage trials. In field trials, we tested the traditional red-sphere Ladd trap against traps for which the sphere was painted blue, black or yellow. The colour of sphere did not significantly influence trap efficiency in these trials, despite the fact the yellow-panel/yellow-sphere presented no colour contrast to the flies. In 6 weeks of field trials, over 1500 flies were caught, almost exactly two-thirds of them being females. Overall, flies were more likely to be caught on the yellow panel than the sphere; but, for the commercial Ladd trap, proportionally more females were caught on the red sphere versus the yellow panel than would be predicted based on relative surface area of each component, a result also seen the field-cage trial. We determined that no modification of the trap was more effective than the commercially available Ladd trap and so consider that product suitable for more extensive field testing as a B. tryoni research and monitoring tool.
Resumo:
For purposes of interstate and international fruit trade, it is necessary to demonstrate that in areas in which fruit fly species have not previously established permanent populations, but which are subject to introductions of fruit flies from outside the area, the introduced population once detected, has not become established. In this paper, we apply methodology suggested mainly by Carey (1991, 1995) to introductions of Mediterranean fruit fly (Medfly), Ceratitis capitata Weid., and Queensland fruit fly (QFF) Bactrocera tryoni Froggatt (Diptera: Tephritidae) to South Australia, a state in which these species do not occur naturally and in which introductions, once detected, are actively treated. By analysing historical data associated with fruit fly outbreaks in South Australia, we demonstrate that: (i) fruit flies occur seasonally, as would occur in established populations, except there is no evidence of the critical spring generation of either species; (ii) there is no evidence of increasing frequency of outbreaks, trapped flies or larval occurrences over 29 years; (iii) there is no evidence of decreasing time between catches of adult flies as the years progress; (iv) there is no decrease in the mean number of years between outbreaks in the same locations; (v) there is no statistically significant recurrence of outbreaks in the same locations in successive years; (vi) there is no evidence of spread of outbreaks outwards from a central location; (vii) the likelihood of outbreaks in a city or town is related to the size of the human population; (viii) introduction pathways by road from Western Australia (for Medfly) and eastern Australia (for QFF) are shown to exist and to illegally or accidentally carry considerable amounts of fruit into South Australia; and (ix) there was no association between the numbers of either Queensland fruit fly or Medfly and the spatial pattern of either loquat or cumquat trees as sources of larval food in spring. This analysis supports the hypothesis that most fruit fly outbreaks in South Australia have been the result of separate introductions of infested fruit by vehicular traffic and that most of the resultant fly outbreaks were detected and died out within a few weeks of the application of eradication procedures. An alternative hypothesis, that populations of fruit flies are established in South Australia at below detectable levels, is impossible to disprove with conventional technology, but the likelihood of it being true is minimised by our analysis. Both hypotheses could be tested soon with newly developed genetic techniques.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.