935 resultados para Fly casting


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

On cover: Fly casting for the novice and the expert.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Short bibliography included in the preface.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The success of metal-ceramic restorations depends on an optimal bond between metal and ceramic. This study evaluated the effect of 3 casting atmospheres on the metal-ceramic bond strength (MCBS) of 2 Ni-Cr alloys, with beryllium (Fit Cast V) and without beryllium (Fit Cast SB). Sixty acrylic resin patterns (8 mm long and 5 mm diameter) were obtained using a fluorocarbon resin matrix. Wax was used to refine the surface of acrylic resin patterns that were invested and cast in an induction casting machine under normal, vacuum, and argon atmospheres at a temperature of 1340ºC. The castings were divested manually and airborne-particle abraded with 100-µm aluminum-oxide. Ten castings were obtained for each group. The IPS Classic V ceramic was applied (2 mm high and 5 mm diameter). The shear bond strength was tested in a mechanical testing machine with a crosshead speed of 2.0 mm/min. The MCBS data (MPa) were subjected to 2-way analysis of variance (α=0.05). There was no statistically significant difference (p>0.05) between the alloys or among the casting atmospheres. Within the limitations of this study, it may be concluded that the presence of beryllium and the casting atmosphere did not interfere in the MCBS of the evaluated metal-ceramic combinations

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The interest in using titanium to fabricate removable partial denture (RPD) frameworks has increased, but there are few studies evaluating the effects of casting methods on clasp behavior. OBJECTIVE: This study compared the occurrence of porosities and the retentive force of commercially pure titanium (CP Ti) and cobalt-chromium (Co-Cr) removable partial denture circumferential clasps cast by induction/centrifugation and plasma/vacuum-pressure. MATERIAL AND METHODS: 72 frameworks were cast from CP Ti (n=36) and Co-Cr alloy (n=36; control group). For each material, 18 frameworks were casted by electromagnetic induction and injected by centrifugation, whereas the other 18 were casted by plasma and injected by vacuum-pressure. For each casting method, three subgroups (n=6) were formed: 0.25 mm, 0.50 mm, and 0.75 mm undercuts. The specimens were radiographed and subjected to an insertion/removal test simulating 5 years of framework use. Data were analyzed by ANOVA and Tukey's to compare materials and cast methods (α=0.05). RESULTS: Three of 18 specimens of the induction/centrifugation group and 9 of 18 specimens of plasma/vacuum-pressure cast presented porosities, but only 1 and 7 specimens, respectively, were rejected for simulation test. For Co-Cr alloy, no defects were found. Comparing the casting methods, statistically significant differences (p<0.05) were observed only for the Co-Cr alloy with 0.25 mm and 0.50 mm undercuts. Significant differences were found for the 0.25 mm and 0.75 mm undercuts dependent on the material used. For the 0.50 mm undercut, significant differences were found when the materials were induction casted. CONCLUSION: Although both casting methods produced satisfactory CP Ti RPD frameworks, the occurrence of porosities was greater in the plasma/vacuum-pressure than in the induction/centrifugation method, the latter resulting in higher clasp rigidity, generating higher retention force values.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.