Sistema de monitoramento de perdas visíveis de cana-de-açúcar em colhedora de cana picada

In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.

Variáveis objetivas e subjetivas para monitoramento de diferentes ciclos de temporada em jogadores de basquete

The present study aimed to evaluate, compare and relate load and training tiredness during a periodization cycle in basketball players. Eight professional male athletes aged 21.9 ± 3.4 years, all of whom participated in the São Paulo basketball championship, special division, took part in this study. The macrocycle analyzed encompassed 19 weeks divided into the following periods: Preparatory, Competitive I, and Competitive II (having 4, 6, and 9 weeks, respectively). The authors daily evaluated the athletes on subjective perception of tiredness and training load and monitored the athletes' upper limb power by quantifying their ability to throw a medicine ball. Athletes presented less fatigue (p <0.005) in the Preparatory period (13.71 ± 1.30) compared with the Competitive I (14.68 ± 1.51) and Competitive II (14.63 ± 1.22) periods. Their ability to throw the medicine ball decreased (p <0.005) in the Competitive period II (3.59 ± 0.30) compared with the Preparatory (3.80 ± 0.36) and Competitive I (3.86 ± 0.26) periods. Their monotony decreased (p <0.001) in the Competitive period II (1.18 ± 0.43) compared with the Preparatory (2.50 ± 2.01) and Competitive I (2.10 ± 1.61) periods. The results revealed the effectiveness of monitoring load and tiredness of athletes by means of the proposed method to assist in training organization during a macrocycle.

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos da temperatura do ar, linhagem e período do dia nas freqüências de ocorrências e tempos de expressão comportamental de matrizes pesadas

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Mapeamento de semeaduras de soja (Glycine max (L.)Merr.) mediante dados MODIS/Terra E TM/Landsat 5: um comparativo

The objective of this work was to compare the soybean crop mapping in the western of Parana State by MODIS/Terra and TM/Landsat 5 images. Firstly, it was generated a soybean crop mask using six TM images covering the crop season, which was used as a reference. The images were submitted to Parallelepiped and Maximum Likelihood digital classification algorithms, followed by visual inspection. Four MODIS images, covering the vegetative peak, were classified using the Parallelepiped method. The quality assessment of MODIS and TM classification was carried out through an Error Matrix, considering 100 sample points between soybean or not soybean, randomly allocated in each of the eight municipalities within the study area. The results showed that both the Overall Classification (OC) and the Kappa Index (KI) have produced values ranging from 0.55 to 0.80, considered good to very good performances, either in TM or MODIS images. When OC and KI, from both sensors were compared, it wasn't found no statistical difference between them. The soybean mapping, using MODIS, has produced 70% of reliance in terms of users. The main conclusion is that the mapping of soybean by MODIS is feasible, with the advantage to have better temporal resolution than Landsat, and to be available on the internet, free of charge.

Perfis temporais NDVI MODIS, na cana-soca, de maturação tardia

This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.

Modelos de regressão lineares para estimativa de produtividade da soja no oeste do Paraná, utilizando dados espectrais

The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Utilização dos testes de função tireoidiana na prática clínica

Laboratory tests are essential for accurate diagnosis and cost-effective management of thyroid disorders. When the clinical suspicion is strong, hormonal levels just confirms the diagnosis. However, in most patients, symptoms are subtle and unspecific, so that only biochemical tests can detect the disorder. The objective of this article is to do a critical analysis of the appropriate use of the most important thyroid function tests, including serum concentrations of thyrotropin (TSH), thyroid hormones and antithyroid antibodies. Through a survey in the MedLine database, we discuss the major pitfalls and interferences related to daily use of these tests and recommendations are presented to optimize the use of these diagnostic tools in clinical practice.

Crescimento fisico em crianças e adolescentes de moderada altitude

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física

Medida da capacidade antioxidante de fluidos biologicos por voltametria de pulso diferencial associada ao uso de surfactante como resposta as adaptações geradas pelo exercicio

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito de onze semanas de treinamento sobre a velocidade critica e o limiar anaerobio em nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do perfil de humor e da enzima alfa-amilase salivar em indivíduos fisicamente ativos = : Analysis of profile of mood states and salivary alpha amylase enzyme in physically active individuals

Universidade Estadual de Campinas . Faculdade de Educação Física