21 resultados para metodologia de detecção
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The aim of this work was to develop and to validate a methodology using HPLC for the simultaneous determination of folates and folic acid in foods. The limits of detection and the recovery rates for the vitamins in the certified reference materials were respectively 5 pg/mL and 94-108% for 5-MTHF, 7 pg/mL and 97-102% for THF, 30 pg/mL and 97.9-104% for 5-FTHF, 30 pg/mL and 95-107 for 10-FFA, 5 ng/mL and 97-102% for FA and 5 ng/mL and 98-103% for 10-MFA. Repeatability showed a coefficient of variation below 3.9% for all the vitamins. The proposed methodology was shown to be efficient when applied to different certified reference materials, namely pig's liver (BCR487), powdered milk (BCR421) and a vegetable mixture (BCR485).
Resumo:
The use of antioxidants either to prevent or retard food's lipids oxidation was approved after inquires that verified their security within a daily intake limit. In this study, the methodology was developed and validated for the analysis of synthetic antioxidants: propylgallate (PG), tert-butylhydroquinone (TBHQ), butylhydroxyanisole (BHA), octylgallate (OG) and butylhydroxytoluene (BHT) in vegetables oils, margarine and hydrogenated fats by high performance liquid chromatographic. The methodology revealed itself efficient, with recovery rates above 90% for all antioxidant substances, besides good linearity in concentration range of 40-240 mg kg-1 (r = 0,999), repeatability with CV < 3,7% and limit of quantification 16.55, 10.32, 1.40, 3.76 and 9.30 mg/kg for BHT, BHA, PG, OG and TBHQ, respectively.
Resumo:
Optical chemical sensors with detection in the near and mid infrared region are reviewed. Fundamental concepts of infrared spectroscopy and optical chemical sensors are briefly described, before presenting some aspects on optical chemical sensors, such as synthesis of NIR and IR reagents, preparation of new materials as well as application in determinations of species of biological, industrial and environmental importance.
Resumo:
This works describes the use of experimental design and surface response methodology for optimization of saponin extraction from Ampelozizyphus amazonicus. For this purpose, a method employing extraction based on maceration assisted by ultrasound technique was utilized. The following factors were studied: extraction length of time and solvent composition. The total saponin was determined by using a gravimetric method and the results expressed by their relative proportion to total crude extract. For the specific condition, 60% hydro-alcoholic solution and 18 minutes extraction length of time has shown the best results. This method can be useful for extraction of substances with biological importance
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física