Cytogenetic And Morphologic Approaches Of Hybrids From Experimental Crosses Between Triatoma Lenti Sherlock & Serafim, 1967 And T. Sherlocki Papa Et Al., 2002 (hemiptera: Reduviidae).

The reproductive capacity between Triatoma lenti and Triatoma sherlocki was observed in order to verify the fertility and viability of the offspring. Cytogenetic, morphological and morphometric approaches were used to analyze the differences that were inherited. Experimental crosses were performed in both directions. The fertility rate of the eggs in crosses involving T. sherlocki females was 65% and 90% in F1 and F2 offspring, respectively. In reciprocal crosses, it was 7% and 25% in F1 and F2 offspring, respectively. The cytogenetic analyses of the male meiotic process of the hybrids were performed using lacto-acetic orcein, C-banding and Feulgen techniques. The male F1 offspring presented normal chromosome behavior, a finding that was similar to those reported in parental species. However, cytogenetic analysis of F2 offspring showed errors in chromosome pairing. This post-zygotic isolation, which prevents hybrids in nature, may represent the collapse of the hybrid. This phenomenon is due to a genetic dysregulation that occurs in the chromosomes of F1. The results were similar in the hybrids from both crosses. Morphological features, such as color and size of connexive and the presence of red-orange rings on the femora, were similar to T. sherlocki, while wins size was similar to T. lenti in F1 offspring. The eggshells showed characteristics that were similar to species of origin, whereas the median process of the pygophore resulted in intermediate characteristics in the F1 and a segregating pattern in F2 offspring. Geometric morphometric techniques used on the wings showed that both F1 and F2 offspring were similar to T. lenti. These studies on the reproductive capacity between T. lenti and T. sherlocki confirm that both species are evolutionarily closed; hence, they are included in the brasiliensis subcomplex. The extremely reduced fertility observed in the F2 hybrids confirmed the specific status of the species that were analyzed.

Transmission Of Intra-cellular Genetic Information: A System Proposal.

One of the great challenges of the scientific community on theories of genetic information, genetic communication and genetic coding is to determine a mathematical structure related to DNA sequences. In this paper we propose a model of an intra-cellular transmission system of genetic information similar to a model of a power and bandwidth efficient digital communication system in order to identify a mathematical structure in DNA sequences where such sequences are biologically relevant. The model of a transmission system of genetic information is concerned with the identification, reproduction and mathematical classification of the nucleotide sequence of single stranded DNA by the genetic encoder. Hence, a genetic encoder is devised where labelings and cyclic codes are established. The establishment of the algebraic structure of the corresponding codes alphabets, mappings, labelings, primitive polynomials (p(x)) and code generator polynomials (g(x)) are quite important in characterizing error-correcting codes subclasses of G-linear codes. These latter codes are useful for the identification, reproduction and mathematical classification of DNA sequences. The characterization of this model may contribute to the development of a methodology that can be applied in mutational analysis and polymorphisms, production of new drugs and genetic improvement, among other things, resulting in the reduction of time and laboratory costs.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da redução medicamentosa da pressão intra-ocular na medida da espessura da camada de fibras nervosas da retina de olhos hipertensos e glaucomatosos pela polarimetria de varredura a laser

PURPOSE: To evaluate changes in retinal nerve fiber layer thickness as measured by scanning laser polarimetry (SLP) after the use of medication to reduce intraocular pressure (IOP) in glaucomatous or ocular hypertensive patients. METHODS: The authors prospectively enrolled 37 eyes of 37 patients in whom IOP was reduced by more than 25% after the use of medication. The images were obtained before and 15 to 30 days after the introduction of medication. The SLP parameters measured before and after the use of medication were compared using paired Student's t Test. RESULTS: The mean IOP was significantly reduced from 26.57±4.23 mmHg to 16.54 ±2.92 mmHg after the use of medication (p<0.05). None of the 10 SLP analyzed parameters was significantly affected by the reduction of IOP with medication (p>0.05). CONCLUSION: The retinal nerve fiber layer thickness, as measured by SLP, is not affected by the reduction of IOP with medication in patients with glaucoma or ocular hypertension.

Educação pelo lazer : valores que envolvem a relação adulto-criança

Universidade Estadual de Campinas . Faculdade de Educação Física