Management Of Severe Thoracic Impalement Trauma Against Two-wheeled Horse Carriage: A Case Report And Literature Review.

Thoracic injuries in general are of great importance due to their high incidence and high mortality. Thoracic impalement injuries are rare but severe due to the combination of cause, effect and result. This study's primary objective is to report the case of a young man who was impaled by a two-wheeled horse carriage shaft while crashing his motorcycle in a rural zone. An EMT-B ferry was called at the crash scene and a conscious patient was found, sustaining a severe impalement injury to the left hemithorax, suspended over the floor by the axial skeleton with the carriage shaft coming across his left chest. As a secondary objective, a literature review of thoracic impalement injuries is performed. Cases of thoracic impalement injury require unique and individualized care based on injury severity and affected organs. Reported protocols for managing impalement injuries are entirely anecdotal, with no uniformity on impaled patient's approach and management. In penetrating trauma, it is essential not to remove the impaled object, so that possible vascular lesions remain buffered by the object, avoiding major bleeding and exsanguination haemorrhage. Severed impaled thoracic patients should be transferred to a specialist centre for trauma care, as these lesions typically require complex multidisciplinary treatment. High-energy thoracic impalement injuries are rare and hold a high mortality rate, due to the complexity of trauma and associated injuries such as thoracic wall and lung lesions. Modern medicine still seems limited in cases of such seriousness, not always with satisfactory results.

Efeitos da cobertura do solo com filme de polietileno azul no consumo de água da cultura da alface cultivada em estufa

The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.

Eficiência do processo de recobrimento de sementes de brócolos recobertas com polímero em leito de jorro

Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.

Filtros de areia aplicados à irrigação localizada: teoria e prática

The application of sand filters in localized irrigation systems is recommended in the presence of organic and algae contamination. The proper design and maintenance of these equipments are essential to assure an effective water quality control, in order to reduce the emitters clogging, to keep its water application uniformity, and to prevent increasing in the system operation costs. Despite the existence of some references about design, operation and maintenance of these filters, they are dispersed, with not enough details to guarantee the optimization of its hydraulics structure design and the proper selection of porous media to be used. Therefore, the objective of this work was to report a current literature review, relating practical information with scientific knowledge. The content of this review would help to induce and intensify the research on this subject and to contribute so the operational functions for the equipment are reached. It is also expected to assist the improvement of the filtration and flushing processes in the agricultural irrigation and the development of original design procedures and the rational use of these devices.

Germinação de esporos de Polypodium pleopeltifolium: resultados preliminares

Polypodium pleopeltifolium is an epiphytic fern which occurs in cerrado vegetation of the State of São Paulo, Brazil. The species is light sensitive for germination but some spores germinate in the absence of light. Short treatments at 40 or 5ºC and alternating temperatures did not increase the germination in dark conditions. Germination was not affected by IAA but it was reduced by GA3, CEPA and ABA. Red light (short treatments) promoted germination.

Dispersão de sementes de Vismia cayennensis (Jacq.) Pers. (Guttiferae) por morcegos na região de Manaus, Amazonas

We studied the feeding behavior of bats and their role in the seed dispersal of Vismia cayennensis in Manaus region, Amazonas State, northern Brazil. The characteristics of the plant and its fruits fit the chiropterocory syndrome. Five species of phyllostomid bats fed on Vismia fruits: Sturnira lilium, Sturnira tildae, Artibeus concolor, Carollia perspicillata and Rhinophylla pumilio. Apparently there is a relationship between flock foraging behavior and fruit availability in early night. The feeding behavior was similar for all bat species, varying with the presentation mode of the fruits. Seed germination tests and the distributional patterns of the plants indicate that bats are the dispersers of V. cayennensis.

Germinação e crescimento de Calophyllum brasiliense (Clusiaceae), uma espécie típica de florestas inundadas

Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Germinação de Ternstroemia brasiliensis Cambess. (Pentaphylacaceae) de floresta de restinga

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Fluidodinâmica de sementes de brócolos em leito fluizado e leito de jorro

The spouted and fluidized bed technologies are usually employed in operations of drying, coating and granulation of particles by the chemical and pharmaceutical industries. The use of these techniques in agronomy is limited to the treatment of some species of seeds. In this work, the objective was to analyse the fluid-dynamics of fluidized and spouted beds when broccoli (Brassica oleracea L. var. Italica) seeds are used and also to verify the influence on seed germination after 60 min of seed exposition to spouting or fluidization, at room temperature. The fluid-dynamics was defined by the measurements of the bed pressure drop as a function of the air flow rate for different seeds loads. The experimental conditions were based on the physical properties of the seeds and were limited by the apparatus dimensions. The cone-cylindrical bed was constructed in plexyglass to permit flow visualization. The values of the parameters: maximum pressure drop, minimum spouting flow rate and pressure drop, and stable spout pressure drop were experimentally obtained from the fluid-dynamic analysis and were compared with the values calculated by empirical equations found in the literature. The same procedure was carried out with the fluidized bed and the important parameters for this regime were the air velocity and the bed pressure drop at minimum fluidization. The analysis of seed germination indicated that no damage was caused to the seeds by the spout or fluidization processes.

Caracterização sensorial de amêndoas de castanha-de-caju fritas e salgadas

Shelled, roasted and salted cashew nut kernels were packaged in three different flexible materials (PP/PE= polypropylene / polyethylene; PETmet/PE= metallized polyethylene terephthalate / polyethylene; PET/Al/LDPE= polyethylene terephthalate / aluminum foil / low density polyethylene ), with different barrier properties. Kernels were stored for one year at 30° C and 80% relative humidity. Quantitative descriptive sensory analysis (QDA) were performed at the end of storage time. Descriptive terms obtained for kernels characterization were brown color, color uniformity and rugosity for appearance; toasted kernel, sweet, old and rancidity for odor; toasted kernel, sweet, old rancidity, salt and bitter for taste, crispness for texture. QDA showed that factors responsible for sensory quality decrease, after one year storage, were increase in old aroma and taste, increase in rancidity aroma and taste, decrease in roasted kernel aroma and taste, and decrease of crispness. Sensory quality decrease was higher in kernels packaged in PP/PE.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.