32 resultados para eventos
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Introductions: In the care of hypertension, it is important that health professionals possess available tools that allow evaluating the impairment of the health-related quality of life, according to the severity of hypertension and the risk for cardiovascular events. Among the instruments developed for the assessment of health-related quality of life, there is the Mini-Cuestionario of Calidad de Vida en la Hipertensión Arterial (MINICHAL) recently adapted to the Brazilian culture. Objective: To estimate the validity of known groups of the Brazilian version of the MINICHAL regarding the classification of risk for cardiovascular events, symptoms, severity of dyspnea and target-organ damage. Methods: Data of 200 hypertensive outpatients concerning sociodemographic and clinical information and health-related quality of life were gathered by consulting the medical charts and the application of the Brazilian version of MINICHAL. The Mann-Whitney test was used to compare health-related quality of life in relation to symptoms and target-organ damage. The Kruskal-Wallis test and ANOVA with ranks transformation were used to compare health-related quality of life in relation to the classification of risk for cardiovascular events and intensity of dyspnea, respectively. Results: The MINICHAL was able to discriminate health-related quality of life in relation to symptoms and kidney damage, but did not discriminate health-related quality of life in relation to the classification of risk for cardiovascular events. Conclusion: The Brazilian version of the MINICHAL is a questionnaire capable of discriminating differences on the health‑related quality of life regarding dyspnea, chest pain, palpitation, lipothymy, cephalea and renal damage.Fundamento: No cuidado ao hipertenso, é importante que o profissional de saúde disponha de ferramentas que possibilitem avaliar o comprometimento da qualidade de vida relacionada à saúde, de acordo com a gravidade da hipertensão e o risco para eventos cardiovasculares. Dentre os instrumentos criados para avaliação da qualidade de vida relacionada à saúde, destaca-se o Mini-Cuestionario de Calidad de Vida en la Hipertensión Arterial (MINICHAL), recentemente adaptado para a cultura brasileira. Objetivo: Estimar a validade de grupos conhecidos da versão brasileira do MINICHAL em relação à classificação de risco para eventos cardiovasculares, sintomas, intensidade da dispneia e lesões de órgãos-alvo. Métodos: Foram investigados 200 hipertensos em seguimento ambulatorial, cujos dados sociodemográficos, clínicos e de qualidade de vida relacionada à saúde foram obtidos por meio de consulta ao prontuário e da aplicação da versão brasileira do MINICHAL. O teste de Mann-Whitney foi utilizado para comparar qualidade de vida relacionada à saúde em relação aos sintomas e às lesões de órgãos-alvo. Teste de Kruskal-Wallis e ANOVA com transformação nos ranks foram empregados para comparar qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares e intensidade da dispneia, respectivamente. Resultados: O MINICHAL discriminou qualidade de vida relacionada à saúde em relação aos sintomas e dano renal (lesões de órgãos-alvo), porém não discriminou qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares. Conclusão: A versão brasileira do MINICHAL é um instrumento capaz de discriminar diferenças na qualidade de vida relacionada à saúde em relação aos sintomas de dispneia, precordialgia, palpitação, lipotímia, cefaleia e presença de dano renal.
Resumo:
Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física