Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Unusual branching in the palm Euterpe edulis Mart

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Meningites bacterianas agudas complicações vasculares: vascular complications

The authors present the study of four children with arteritis as vascular complication of acute bacterial meningitis. They report pathophysiological mechanisms involved in vascular lesions, and progress in the understanding of these complications.

Metodos de avaliação em Educação Fisica no ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

Associativismo, lazer e esporte nos clubes sociais de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Lazer na adolescencia : uma analise sobre os skatistas do ABC paulista

Universidade Estadual de Campinas. Faculdade de Educação Física

A Escola Superior de Educação Fisica de Muzambinho no contexto da Educação Fisica brasileira

Universidade Estadual de Campinas . Faculdade de Educação Física

Perfil antropometrico e desempenho fisico-motor de crianças e jovens com deficiencia visual participantes do atletismo nos 1. Jogos Escolares da Confederação Brasileira de Desportos para Cegos

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol : Analises qualitativas e quantitativas para verificação e modulação de padrões e sistemas complexos de jogo

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica, escola e cultura : o enredo das diferenças

Universidade Estadual de Campinas . Faculdade de Educação Física

Lazer e reclusão : contribuições da teoria da ação comunicativa

Universidade Estadual de Campinas . Faculdade de Educação Física

A natureza visitada : um estudo de caso na cidade de Santa Teresa-ES

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do treinamento : metodo, procedimentos pedagogicos e as multiplas competencias do tecnico nos jogos desportivos coletivos

Universidade Estadual de Campinas. Faculdade de Educação Física

Utilização da discriminação grafica de Fisher para indicação dos dermatoglifos como referencial de potencialidade de atletas de basquetebol

Universidade Estadual de Campinas. Faculdade de Educação Física

Educação física e inclusão educacional : entender para atender = Physical education and educational inclusion : understanding to attend

Universidade Estadual de Campinas . Faculdade de Educação Física