15 resultados para domain-specific expertise
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.
Direct Visualization Of The Action Of Triton X-100 On Giant Vesicles Of Erythrocyte Membrane Lipids.
Resumo:
The raft hypothesis proposes that microdomains enriched in sphingolipids, cholesterol, and specific proteins are transiently formed to accomplish important cellular tasks. Equivocally, detergent-resistant membranes were initially assumed to be identical to membrane rafts, because of similarities between their compositions. In fact, the impact of detergents in membrane organization is still controversial. Here, we use phase contrast and fluorescence microscopy to observe giant unilamellar vesicles (GUVs) made of erythrocyte membrane lipids (erythro-GUVs) when exposed to the detergent Triton X-100 (TX-100). We clearly show that TX-100 has a restructuring action on biomembranes. Contact with TX-100 readily induces domain formation on the previously homogeneous membrane of erythro-GUVs at physiological and room temperatures. The shape and dynamics of the formed domains point to liquid-ordered/liquid-disordered (Lo/Ld) phase separation, typically found in raft-like ternary lipid mixtures. The Ld domains are then separated from the original vesicle and completely solubilized by TX-100. The insoluble vesicle left, in the Lo phase, represents around 2/3 of the original vesicle surface at room temperature and decreases to almost 1/2 at physiological temperature. This chain of events could be entirely reproduced with biomimetic GUVs of a simple ternary lipid mixture, 2:1:2 POPC/SM/chol (phosphatidylcholine/sphyngomyelin/cholesterol), showing that this behavior will arise because of fundamental physicochemical properties of simple lipid mixtures. This work provides direct visualization of TX-100-induced domain formation followed by selective (Ld phase) solubilization in a model system with a complex biological lipid composition.
Resumo:
Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
Purpose. To investigate misalignments (MAs) on retinal nerve fiber layer thickness (RNFLT) measurements obtained with Cirrus(©) SD-OCT. Methods. This was a retrospective, observational, cross-sectional study. Twenty-seven healthy and 29 glaucomatous eyes of 56 individuals with one normal exam and another showing MA were included. MAs were defined as an improper alignment of vertical vessels in the en face image. MAs were classified in complete MA (CMA) and partial MA (PMA), according to their site: 1 (superior, outside the measurement ring (MR)), 2 (superior, within MR), 3 (inferior, within MR), and 4 (inferior, outside MR). We compared RNFLT measurements of aligned versus misaligned exams in all 4 sectors, in the superior area (sectors 1 + 2), inferior area (sectors 3 + 4), and within the measurement ring (sectors 2 + 3). Results. RNFLT measurements at 12 clock-hour of eyes with MAs in the superior area (sectors 1 + 2) were significantly lower than those obtained in the same eyes without MAs (P = 0.043). No significant difference was found in other areas (sectors 1 + 2 + 3 + 4, sectors 3 + 4, and sectors 2 + 3). Conclusion. SD-OCT scans with superior MAs may present lower superior RNFLT measurements compared to aligned exams.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.
Resumo:
Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física