34 resultados para desenvolvidos

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Inulin is a fructooligosacharide found in diverse agricultural products, amongst them garlic, banana, Jerusalem artichoke and chicory root. Inulin generally is used in developed countries, as a substitute of sugar and/or fat due to its characteristics of fitting as functional and dietary food. Chicory root is usually used as source and raw material for commercial extration of inulin. The experiments consisted on drying sliced chicory roots based on a factorial experimental design in a convective dryer whose alows the air to pass perpendicularly through the tray. Effective diffusivity (dependent variable) has been determined for each experimental combination of independent variables (air temperature and velocity). The data curves have been fitted by the solution of the second Fick law and Page's model. Effective difusivity varied from 3.51 x 10-10 m² s-1 to 1.036 x 10-10 m² s-1. It is concluded that, for the range of studied values, air temperature is the only statistically significant variable. So, a first order mathematical model was obtained, representing effective diffusivity behavior as function of air temperature. The best drying condition was correspondent to the trial using the highest drying air temperature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PURPOSE: To evaluate the knowledge glaucoma patients have about their disease and its treatment. METHODS: One hundred and eighty-three patients were interviewed at the Glaucoma Service of Wills Eye Hospital (Philadelphia, USA, Group 1) and 100 at the Glaucoma Service of University of Campinas (Campinas, Brazil, Group 2). An informal, relaxed atmosphere was created by the interviewer before asking a list of 18 open-ended questions. RESULTS: In Group 1, 44% of the 183 patients did not have an acceptable idea about what glaucoma is, 30% did not know the purpose of the medications they were taking, 47% were not aware of what was an average intraocular pressure, and 45% did not understand why visual fields were examined. In Group 2, 54% gave unsatisfactory answers to the question What is glaucoma?, 54% did not know the purpose of the medications they were taking, 80% were not aware of what was an average intraocular pressure, and 94% did not understand why visual fields were examined (p<0.001). Linear regression analysis demonstrated that level of education was positively correlated to knowledge about glaucoma in both groups (r=0.65, p=0.001). CONCLUSION: This study showed that patients' knowledge about glaucoma varies greatly, and that in an urban, American setting, around one third of the patients have minimal understanding, whereas in an urban setting in Brazil around two thirds of patients were lacking basic information about glaucoma. Innovative and effective methods are needed to correct this situation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física