Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

[the Sociology Of Health In Brazil - The Creation Of An Identity].

This article analyzes the historical, social and cognitive dimensions of the sociology of medicine in the construction of its identity, from Wolf Lepenies' perspective. It is understood that the construction of an identity does not end with the first historical manifestations, but is consolidated when it is institutionalized and structured as a field of knowledge by creating its own forms of cognitive expression. The text is divided into three parts: in the first the precursors are presented, highlighting the role played by some travelers, naturalists and folklore scholars, followed by social physicians-scientists and the first social scientists (1940-1969). In the second part, aspects of the consolidation of the social sciences in health are presented at two significant moments, namely the 1970s and 1980s. In the third part, the issues raised by the field are addressed in general terms. It is considered that once the main structural stages are in place there is still a need for the formation of new generations of social scientists in health. It is also essential to disseminate scientific production and to ensure that the relations are studied in depth and institutionalized with the sociological matrices on the one hand and with the field of health on the other.

Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

A Putative Otu Domain-containing Protein 1 Deubiquitinating Enzyme Is Differentially Expressed In Thyroid Cancer And Identifies Less-aggressive Tumours.

This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.

Reduced Insulin Clearance And Lower Insulin-degrading Enzyme Expression In The Liver Might Contribute To The Thrifty Phenotype Of Protein-restricted Mice.

Nutrient restriction during the early stages of life usually leads to alterations in glucose homeostasis, mainly insulin secretion and sensitivity, increasing the risk of metabolic disorders in adulthood. Despite growing evidence regarding the importance of insulin clearance during glucose homeostasis in health and disease, no information exists about this process in malnourished animals. Thus, in the present study, we aimed to determine the effect of a nutrient-restricted diet on insulin clearance using a model in which 30-d-old C57BL/6 mice were exposed to a protein-restricted diet for 14 weeks. After this period, we evaluated many metabolic variables and extracted pancreatic islet, liver, gastrocnemius muscle (GCK) and white adipose tissue samples from the control (normal-protein diet) and restricted (low-protein diet, LP) mice. Insulin concentrations were determined using RIA and protein expression and phosphorylation by Western blot analysis. The LP mice exhibited lower body weight, glycaemia, and insulinaemia, increased glucose tolerance and altered insulin dynamics after the glucose challenge. The improved glucose tolerance could partially be explained by an increase in insulin sensitivity through the phosphorylation of the insulin receptor/protein kinase B and AMP-activated protein kinase/acetyl-CoA carboxylase in the liver, whereas the changes in insulin dynamics could be attributed to reduced insulin secretion coupled with reduced insulin clearance and lower insulin-degrading enzyme (IDE) expression in the liver and GCK. In summary, protein-restricted mice not only produce and secrete less insulin, but also remove and degrade less insulin. This phenomenon has the double benefit of sparing insulin while prolonging and potentiating its effects, probably due to the lower expression of IDE in the liver, possibly with long-term consequences.

Sargassum Filipendula Alginate From Brazil: Seasonal Influence And Characteristics.

The aim of this work is focused on the extraction and characterization of the Brazilian seaweed Sargassum filipendula alginate. Alginates obtained at different seasons were characterized by liquid state nuclear magnetic resonance spectroscopy and scanning electron microscopy. The alginate extraction efficiency was about 20%. Different seasons of the year and different stages in the life cycle of Sargassum sp. in southeastern Brazil influenced the M/G and, consequently, the technological properties of extracted alginates.

Last Instar Larvae And Pupae Of Ourocnemis Archytas And Anteros Formosus (lepidoptera: Riodinidae), With A Summary Of Known Host Plants For The Tribe Helicopini.

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Neck Circumference As A New Anthropometric Indicator For Prediction Of Insulin Resistance And Components Of Metabolic Syndrome In Adolescents: Brazilian Metabolic Syndrome Study.

To evaluate the correlation between neck circumference and insulin resistance and components of metabolic syndrome in adolescents with different adiposity levels and pubertal stages, as well as to determine the usefulness of neck circumference to predict insulin resistance in adolescents. Cross-sectional study with 388 adolescents of both genders from ten to 19 years old. The adolescents underwent anthropometric and body composition assessment, including neck and waist circumferences, and biochemical evaluation. The pubertal stage was obtained by self-assessment, and the blood pressure, by auscultation. Insulin resistance was evaluated by the Homeostasis Model Assessment-Insulin Resistance. The correlation between two variables was evaluated by partial correlation coefficient adjusted for the percentage of body fat and pubertal stage. The performance of neck circumference to identify insulin resistance was tested by Receiver Operating Characteristic Curve. After the adjustment for percentage body fat and pubertal stage, neck circumference correlated with waist circumference, blood pressure, triglycerides and markers of insulin resistance in both genders. The results showed that the neck circumference is a useful tool for the detection of insulin resistance and changes in the indicators of metabolic syndrome in adolescents. The easiness of application and low cost of this measure may allow its use in Public Health services.

Screening The Life Cycle Of Schistosoma Mansoni Using High-resolution Mass Spectrometry.

Schistosomiasis is a common tropical disease caused by Schistosoma species Schistosomiasis' pathogenesis is known to vary according to the worms' strain. Moreover, high parasitical virulence is directly related to eggs release and granulomatous inflammation in the host's organs. This virulence might be influenced by different classes of molecules, such as lipids. Therefore, better understanding of the metabolic profile of these organisms is necessary, especially for an increased potential of unraveling strain virulence mechanisms and resistance to existing treatments. In this report, direct-infusion electrospray high-resolution mass spectrometry (ESI(+)-HRMS) along with the lipidomic platform were employed to rapidly characterize and differentiate two Brazilian S. mansoni strains (BH and SE) in three stages of their life cycle: eggs, miracidia and cercariae, with samples from experimental animals (Swiss/SPF mice). Furthermore, urine samples of the infected and uninfected mice were analyzed to assess the possibility of direct diagnosis. All samples were differentiated using multivariate data analysis, PCA, which helped electing markers from distinct lipid classes; phospholipids, diacylglycerols and triacylglycerols, for example, clearly presented different intensities in some stages and strains, as well as in urine samples. This indicates that biochemical characterization of S. mansoni may help narrowing-down the investigation of new therapeutic targets according to strain composition and aggressiveness of disease. Interestingly, lipid profile of infected mice urine varies when compared to control samples, indicating that direct diagnosis of schistosomiasis from urine may be feasible.

Oxidative Stress And Susceptibility To Mitochondrial Permeability Transition Precedes The Onset Of Diabetes In Autoimmune Non-obese Diabetic Mice.

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

Influence Of The Stage Of Ripeness On The Composition Of Iridoids And Phenolic Compounds In Genipap (genipa Americana L.).

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Clinicopathological And Immunohistochemical Evaluation Of Oral And Oropharyngeal Squamous Cell Carcinoma In Chilean Population.

In oral and oropharyngeal squamous cell carcinoma (OCSCC and OPSCC) exist an association between clinical and histopathological parameters with cell proliferation, basal lamina, connective tissue degradation and surrounding stroma markers. We evaluated these associations in Chilean patients. A convenience sample of 37 cases of OCSCC (n=16) and OPSCC (n=21) was analyzed clinically (TNM, clinical stage) and histologically (WHO grade of differentiation, pattern of tumor invasion). We assessed the expression of p53, Ki67, HOXA1, HOXB7, type IV collagen (ColIV) and carcinoma-associated fibroblast (α-SMA-positive cells). Additionally we conducted a univariate/bivariate analysis to assess the relationship of these variables with survival rates. Males were mostly affected (56.2% OCSCC, 76.2% OPSCC). Patients were mainly diagnosed at III/IV clinical stages (68.8% OCSCC, 90.5% OPSCC) with a predominantly infiltrative pattern invasion (62.9% OCSCC, 57.1% OPSCC). Significant association between regional lymph nodes (N) and clinical stage with OCSCC-HOXB7 expression (Chi-Square test P < 0.05) was observed. In OPSCC a statistically significant association exists between p53, Ki67 with gender (Chi-Square test P < 0.05). In OCSCC and OPSCC was statistically significant association between ki67 with HOXA1, HOXB7, and between these last two antigens (Pearson's Correlation test P < 0.05). Furthermore OPSCC-p53 showed significant correlation when it was compared with α-SMA (Kendall's Tau-c test P < 0.05). Only OCSCC-pattern invasion and OPSCC-primary tumor (T) pattern resulted associated with survival at the end of the follow up period (Chi-Square Likelihood Ratio, P < 0.05). Clinical, histological and immunohistochemical features are similar to seen in other countries. Cancer proliferation markers were associated strongly from each other. Our sample highlights prognostic value of T and pattern of invasion, but the conclusions may be limited and should be considered with caution (small sample). Many cases were diagnosed in the advanced stages of the disease, which suggests that the diagnosis of OCSCC and OPSCC is made late.

Selection And Validation Of Reference Genes For Functional Studies In The Calliphoridae Family.

The genera Cochliomyia and Chrysomya contain both obligate and saprophagous flies, which allows the comparison of different feeding habits between closely related species. Among the different strategies for comparing these habits is the use of qPCR to investigate the expression levels of candidate genes involved in feeding behavior. To ensure an accurate measure of the levels of gene expression, it is necessary to normalize the amount of the target gene with the amount of a reference gene having a stable expression across the compared species. Since there is no universal gene that can be used as a reference in functional studies, candidate genes for qPCR data normalization were selected and validated in three Calliphoridae (Diptera) species, Cochliomyia hominivorax Coquerel, Cochliomyia macellaria Fabricius, and Chrysomya albiceps Wiedemann . The expression stability of six genes ( Actin, Gapdh, Rp49, Rps17, α -tubulin, and GstD1) was evaluated among species within the same life stage and between life stages within each species. The expression levels of Actin, Gapdh, and Rp49 were the most stable among the selected genes. These genes can be used as reliable reference genes for functional studies in Calliphoridae using similar experimental settings.

The Use Of Medication And Associated Factors Among Adults Living In Campinas, São Paulo, Brazil: Differences Between Men And Women.

The objective of this study was to verify factors associated with the use of medication by adults, with emphasis on the differences between men and women. It was a population-based, cross-sectional study with cluster sampling conducted in two stages in Campinas in the state of São Paulo in 2008. Among the 2,413 individuals aged 20 or older, the prevalence of use of at least one drug in the three days before the research was 45.4% (95% CI: 41.3 - 49.4) in men and 64.6% (95% CI: 59.8 - 69.2) in women. For adult men over 40 years old who were not working, former smokers, with one or more chronic diseases, with two or more health problems and who sought health care or a health professional in the two weeks preceding the research showed higher prevalence of medication use. Among women, a higher prevalence of use was observed in females over 40, obese, former smokers, who reported a short sleep pattern, with one or more chronic diseases and two or more health problems, and who reported seeking a health care service or professional in the past 15 days. The findings showed some differences in the determinants of drug use in relation to gender, revealing the greater importance of health-related behavior among women.

Applications Of Visual Evoked Potentials And Fourier-domain Optical Coherence Tomography In Parkinson's Disease: A Controlled Study.

The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.