14 resultados para Testemunho do agente encoberto
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
We studied 271 children under age of 15 with diagnosis of acute bacterial meningencephalitis treated at Medical School in Ribeirão Preto, University of São Paulo, between 1980 and 1990. The patients were divided in two groups: 1) those who had not received previous antibiotics treatment (NTP), with 153 cases; and 2), those who had received previous antibiotics treatment (PT), with 118 cases. The etiological agent was more frequently identified in NPT group, while ventriculitis was more frequent in PT group. Mortality rate accounted for 19,5% of all cases, and 29.7% of children under 12 months of age. Acute meningitis caused by Streptococcus pneumoniae was frequently followed by increased mortality. Convulsive disorders and hemiparesis predominante among children under 12 months of age. On the neurosurgical point of view, ventriculitis, subdural hygroma, hydrocephalus, subdural empyema and brain abscess were identified and treated
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física