22 resultados para Strain Field Evolution

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed at evaluating whether human papillomavirus (HPV) groups and E6/E7 mRNA of HPV 16, 18, 31, 33, and 45 are prognostic of cervical intraepithelial neoplasia (CIN) 2 outcome in women with a cervical smear showing a low-grade squamous intraepithelial lesion (LSIL). This cohort study included women with biopsy-confirmed CIN 2 who were followed up for 12 months, with cervical smear and colposcopy performed every three months. Women with a negative or low-risk HPV status showed 100% CIN 2 regression. The CIN 2 regression rates at the 12-month follow-up were 69.4% for women with alpha-9 HPV versus 91.7% for other HPV species or HPV-negative status (P < 0.05). For women with HPV 16, the CIN 2 regression rate at the 12-month follow-up was 61.4% versus 89.5% for other HPV types or HPV-negative status (P < 0.05). The CIN 2 regression rate was 68.3% for women who tested positive for HPV E6/E7 mRNA versus 82.0% for the negative results, but this difference was not statistically significant. The expectant management for women with biopsy-confirmed CIN 2 and previous cytological tests showing LSIL exhibited a very high rate of spontaneous regression. HPV 16 is associated with a higher CIN 2 progression rate than other HPV infections. HPV E6/E7 mRNA is not a prognostic marker of the CIN 2 clinical outcome, although this analysis cannot be considered conclusive. Given the small sample size, this study could be considered a pilot for future larger studies on the role of predictive markers of CIN 2 evolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Very high field (29)Si-NMR measurements using a fully (29)Si-enriched URu(2)Si(2) single crystal were carried out in order to microscopically investigate the hidden order (HO) state and adjacent magnetic phases in the high field limit. At the lowest measured temperature of 0.4 K, a clear anomaly reflecting a Fermi surface instability near 22 T inside the HO state is detected by the (29)Si shift, (29)K(c). Moreover, a strong enhancement of (29)K(c) develops near a critical field H(c) ≃ 35.6 T, and the ^{29}Si-NMR signal disappears suddenly at H(c), indicating the total suppression of the HO state. Nevertheless, a weak and shifted (29)Si-NMR signal reappears for fields higher than H(c) at 4.2 K, providing evidence for a magnetic structure within the magnetic phase caused by the Ising-type anisotropy of the uranium ordered moments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To analyze the effects of treatment approach on the outcomes of newborns (birth weight [BW] < 1,000 g) with patent ductus arteriosus (PDA), from the Brazilian Neonatal Research Network (BNRN) on: death, bronchopulmonary dysplasia (BPD), severe intraventricular hemorrhage (IVH III/IV), retinopathy of prematurity requiring surgical (ROPsur), necrotizing enterocolitis requiring surgery (NECsur), and death/BPD. This was a multicentric, cohort study, retrospective data collection, including newborns (BW < 1000 g) with gestational age (GA) < 33 weeks and echocardiographic diagnosis of PDA, from 16 neonatal units of the BNRN from January 1, 2010 to Dec 31, 2011. Newborns who died or were transferred until the third day of life, and those with presence of congenital malformation or infection were excluded. Groups: G1 - conservative approach (without treatment), G2 - pharmacologic (indomethacin or ibuprofen), G3 - surgical ligation (independent of previous treatment). Factors analyzed: antenatal corticosteroid, cesarean section, BW, GA, 5 min. Apgar score < 4, male gender, Score for Neonatal Acute Physiology Perinatal Extension (SNAPPE II), respiratory distress syndrome (RDS), late sepsis (LS), mechanical ventilation (MV), surfactant (< 2 h of life), and time of MV. death, O2 dependence at 36 weeks (BPD36wks), IVH III/IV, ROPsur, NECsur, and death/BPD36wks. Student's t-test, chi-squared test, or Fisher's exact test; Odds ratio (95% CI); logistic binary regression and backward stepwise multiple regression. Software: MedCalc (Medical Calculator) software, version 12.1.4.0. p-values < 0.05 were considered statistically significant. 1,097 newborns were selected and 494 newborns were included: G1 - 187 (37.8%), G2 - 205 (41.5%), and G3 - 102 (20.6%). The highest mortality was observed in G1 (51.3%) and the lowest in G3 (14.7%). The highest frequencies of BPD36wks (70.6%) and ROPsur were observed in G3 (23.5%). The lowest occurrence of death/BPD36wks occurred in G2 (58.0%). Pharmacological (OR 0.29; 95% CI: 0.14-0.62) and conservative (OR 0.34; 95% CI: 0.14-0.79) treatments were protective for the outcome death/BPD36wks. The conservative approach of PDA was associated to high mortality, the surgical approach to the occurrence of BPD36wks and ROPsur, and the pharmacological treatment was protective for the outcome death/BPD36wks.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Local parity-odd domains are theorized to form inside a quark-gluon plasma which has been produced in high-energy heavy-ion collisions. The local parity-odd domains manifest themselves as charge separation along the magnetic field axis via the chiral magnetic effect. The experimental observation of charge separation has previously been reported for heavy-ion collisions at the top RHIC energies. In this Letter, we present the results of the beam-energy dependence of the charge correlations in Au+Au collisions at midrapidity for center-of-mass energies of 7.7, 11.5, 19.6, 27, 39, and 62.4 GeV from the STAR experiment. After background subtraction, the signal gradually reduces with decreased beam energy and tends to vanish by 7.7 GeV. This implies the dominance of hadronic interactions over partonic ones at lower collision energies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines the spatial pattern of ill-defined causes of death across Brazilian regions, and its relationship with the evolution of completeness of the deaths registry and changes in the mortality age profile. We make use of the Brazilian Health Informatics Department mortality database and population censuses from 1980 to 2010. We applied demographic methods to evaluate the quality of mortality data for 137 small areas and correct for under-registration of death counts when necessary. The second part of the analysis uses linear regression models to investigate the relationship between, on the one hand, changes in death counts coverage and age profile of mortality, and on the other, changes in the reporting of ill-defined causes of death. The completeness of death counts coverage increases from about 80% in 1980-1991 to over 95% in 2000-2010 at the same time the percentage of ill-defined causes of deaths reduced about 53% in the country. The analysis suggests that the government's efforts to improve data quality are proving successful, and they will allow for a better understanding of the dynamics of health and the mortality transition.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A proper cast is essential for a successful rehabilitation with implant prostheses, in order to produce better structures and induce less strain on the implants. The aim of this study was to evaluate the precision of four different mold filling techniques and verify an accurate methodology to evaluate these techniques. A total of 40 casts were obtained from a metallic matrix simulating three unit implant-retained prostheses. The molds were filled using four different techniques in four groups (n = 10): Group 1 - Single-portion filling technique; Group 2 - Two-step filling technique; Group 3 - Latex cylinder technique; Group 4 - Joining the implant analogs previously to the mold filling. A titanium framework was obtained and used as a reference to evaluate the marginal misfit and tension forces in each cast. Vertical misfit was measured with an optical microscope with an increase of 120 times following the single-screw test protocol. Strain was quantified using strain gauges. Data were analyzed using one-way ANOVA (Tukey's test) (α =0.05). The correlation between strain and vertical misfit was evaluated by Pearson test. The misfit values did not present statistical difference (P = 0.979), while the strain results showed statistical difference between Groups 3 and 4 (P = 0.027). The splinting technique was considered to be as efficient as the conventional technique. The strain gauge methodology was accurate for strain measurements and cast distortion evaluation. There was no correlation between strain and marginal misfit.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The evolution and population dynamics of avian coronaviruses (AvCoVs) remain underexplored. In the present study, in-depth phylogenetic and Bayesian phylogeographic studies were conducted to investigate the evolutionary dynamics of AvCoVs detected in wild and synanthropic birds. A total of 500 samples, including tracheal and cloacal swabs collected from 312 wild birds belonging to 42 species, were analysed using molecular assays. A total of 65 samples (13%) from 22 bird species were positive for AvCoV. Molecular evolution analyses revealed that the sequences from samples collected in Brazil did not cluster with any of the AvCoV S1 gene sequences deposited in the GenBank database. Bayesian framework analysis estimated an AvCoV strain from Sweden (1999) as the most recent common ancestor of the AvCoVs detected in this study. Furthermore, the analysis inferred an increase in the AvCoV dynamic demographic population in different wild and synanthropic bird species, suggesting that birds may be potential new hosts responsible for spreading this virus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física