12 resultados para Spores germination
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Polypodium pleopeltifolium is an epiphytic fern which occurs in cerrado vegetation of the State of São Paulo, Brazil. The species is light sensitive for germination but some spores germinate in the absence of light. Short treatments at 40 or 5ºC and alternating temperatures did not increase the germination in dark conditions. Germination was not affected by IAA but it was reduced by GA3, CEPA and ABA. Red light (short treatments) promoted germination.
Resumo:
Spores of the tropical mosses Pyrrhobryum spiniforme, Neckeropsis undulata and N. disticha were characterized regarding size, number per capsule and viability. Chemical substances were analyzed for P. spiniforme and N. undulata spores. Length of sporophyte seta (spore dispersal ability) was analyzed for P. spiniforme. Four to six colonies per species in each site (lowland and highland areas of an Atlantic Forest; Serra do Mar State Park, Brazil) were visited for the collection of capsules (2008 - 2009). Neckeropsis undulata in the highland area produced the largest spores (ca. 19 µm) with the highest viability. The smallest spores were found in N. disticha in the lowland (ca. 13 µm). Pyrrhobryum spiniforme produced more spores per capsule in the highland (ca. 150,000) than in lowland (ca. 40,000); longer sporophytic setae in the lowland (ca. 64 mm) than in the highland (ca. 43 mm); and similar sized spores in both areas (ca. 16 µm). Spores of N. undulata and P. spiniforme contained lipids and proteins in the cytoplasm, and acid/neutral lipids and pectins in the wall. Lipid bodies were larger in N. undulata than in P. spiniforme. No starch was recorded for spores. Pyrrhobryum spiniforme in the highland area, different from lowland, was characterized by low reproductive effort, but presented many spores per capsule.
Resumo:
The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.
Resumo:
Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.
Resumo:
We studied the feeding behavior of bats and their role in the seed dispersal of Vismia cayennensis in Manaus region, Amazonas State, northern Brazil. The characteristics of the plant and its fruits fit the chiropterocory syndrome. Five species of phyllostomid bats fed on Vismia fruits: Sturnira lilium, Sturnira tildae, Artibeus concolor, Carollia perspicillata and Rhinophylla pumilio. Apparently there is a relationship between flock foraging behavior and fruit availability in early night. The feeding behavior was similar for all bat species, varying with the presentation mode of the fruits. Seed germination tests and the distributional patterns of the plants indicate that bats are the dispersers of V. cayennensis.
Resumo:
Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.
Resumo:
Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.
Resumo:
The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.
Resumo:
The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.
Resumo:
The spouted and fluidized bed technologies are usually employed in operations of drying, coating and granulation of particles by the chemical and pharmaceutical industries. The use of these techniques in agronomy is limited to the treatment of some species of seeds. In this work, the objective was to analyse the fluid-dynamics of fluidized and spouted beds when broccoli (Brassica oleracea L. var. Italica) seeds are used and also to verify the influence on seed germination after 60 min of seed exposition to spouting or fluidization, at room temperature. The fluid-dynamics was defined by the measurements of the bed pressure drop as a function of the air flow rate for different seeds loads. The experimental conditions were based on the physical properties of the seeds and were limited by the apparatus dimensions. The cone-cylindrical bed was constructed in plexyglass to permit flow visualization. The values of the parameters: maximum pressure drop, minimum spouting flow rate and pressure drop, and stable spout pressure drop were experimentally obtained from the fluid-dynamic analysis and were compared with the values calculated by empirical equations found in the literature. The same procedure was carried out with the fluidized bed and the important parameters for this regime were the air velocity and the bed pressure drop at minimum fluidization. The analysis of seed germination indicated that no damage was caused to the seeds by the spout or fluidization processes.
Resumo:
This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.