Advancing Bag-of-visual-words Representations For Lesion Classification In Retinal Images.

Diabetic Retinopathy (DR) is a complication of diabetes that can lead to blindness if not readily discovered. Automated screening algorithms have the potential to improve identification of patients who need further medical attention. However, the identification of lesions must be accurate to be useful for clinical application. The bag-of-visual-words (BoVW) algorithm employs a maximum-margin classifier in a flexible framework that is able to detect the most common DR-related lesions such as microaneurysms, cotton-wool spots and hard exudates. BoVW allows to bypass the need for pre- and post-processing of the retinographic images, as well as the need of specific ad hoc techniques for identification of each type of lesion. An extensive evaluation of the BoVW model, using three large retinograph datasets (DR1, DR2 and Messidor) with different resolution and collected by different healthcare personnel, was performed. The results demonstrate that the BoVW classification approach can identify different lesions within an image without having to utilize different algorithms for each lesion reducing processing time and providing a more flexible diagnostic system. Our BoVW scheme is based on sparse low-level feature detection with a Speeded-Up Robust Features (SURF) local descriptor, and mid-level features based on semi-soft coding with max pooling. The best BoVW representation for retinal image classification was an area under the receiver operating characteristic curve (AUC-ROC) of 97.8% (exudates) and 93.5% (red lesions), applying a cross-dataset validation protocol. To assess the accuracy for detecting cases that require referral within one year, the sparse extraction technique associated with semi-soft coding and max pooling obtained an AUC of 94.2 ± 2.0%, outperforming current methods. Those results indicate that, for retinal image classification tasks in clinical practice, BoVW is equal and, in some instances, surpasses results obtained using dense detection (widely believed to be the best choice in many vision problems) for the low-level descriptors.

Direct Visualization Of The Action Of Triton X-100 On Giant Vesicles Of Erythrocyte Membrane Lipids.

The raft hypothesis proposes that microdomains enriched in sphingolipids, cholesterol, and specific proteins are transiently formed to accomplish important cellular tasks. Equivocally, detergent-resistant membranes were initially assumed to be identical to membrane rafts, because of similarities between their compositions. In fact, the impact of detergents in membrane organization is still controversial. Here, we use phase contrast and fluorescence microscopy to observe giant unilamellar vesicles (GUVs) made of erythrocyte membrane lipids (erythro-GUVs) when exposed to the detergent Triton X-100 (TX-100). We clearly show that TX-100 has a restructuring action on biomembranes. Contact with TX-100 readily induces domain formation on the previously homogeneous membrane of erythro-GUVs at physiological and room temperatures. The shape and dynamics of the formed domains point to liquid-ordered/liquid-disordered (Lo/Ld) phase separation, typically found in raft-like ternary lipid mixtures. The Ld domains are then separated from the original vesicle and completely solubilized by TX-100. The insoluble vesicle left, in the Lo phase, represents around 2/3 of the original vesicle surface at room temperature and decreases to almost 1/2 at physiological temperature. This chain of events could be entirely reproduced with biomimetic GUVs of a simple ternary lipid mixture, 2:1:2 POPC/SM/chol (phosphatidylcholine/sphyngomyelin/cholesterol), showing that this behavior will arise because of fundamental physicochemical properties of simple lipid mixtures. This work provides direct visualization of TX-100-induced domain formation followed by selective (Ld phase) solubilization in a model system with a complex biological lipid composition.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudo da postura corporal e aspectos nutricionais em escolares do ensino fundamental da rede publica

Universidade Estadual de Campinas. Faculdade de Educação Física

Da avaliação a gestão de processo : uma proposta de instrumento para acompanhamento da inclusão contextualizada no transcorrer de atividades motoras

Universidade Estadual de Campinas . Faculdade de Educação Física

Coordenação motora de portadores de deficiencia mental : avaliação e intervenção

Universidade Estadual de Campinas. Faculdade de Educação Física