Preparação de nanopartículas de prata e ouro: um método simples para a introdução da nanociência em laboratório de ensino

A new practical experiment involving silver and gold nanoparticle syntheses was introduced in an inorganic chemistry laboratory course for undergraduate students at the Institute of Chemistry, UNICAMP. The nanoparticles were synthesized by the reduction of silver nitrate and tetrachloroauric acid with sodium borohydride and sodium citrate in an aqueous medium. Stabilities of the suspensions were tested using several different reactants including sodium chloride, polyvinylpyrrolidone, polyvinyl alcohol and cistamine. Changes in optical properties were observed by electronic spectra and also by transmission electronic microscopy, which also yielded data for estimating particle size.

Durabilidade de compósito biomassa vegetal-cimento modificado por polímero

The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.

Caracterização física e mecânica de argamassas à base de cimento Portland e cinza de casca de arroz residual

Rice husk, employed as an energy source at milling industries in Brazil generates, after burning, a dark ash. This residue is not yet conveniently disposed, being currently dumped on large areas, causing environmental problems. This research intended to evaluate the applications of residual rice husk ashes (RHA) as a partial replacement of cement for mortar production. Rice husk ash was chemically characterized through X-ray fluorescence, determination of carbon content, X-ray diffraction, and laser granulometric analysis. Mortar specimens were submitted to two different exposure conditions: internal and external environments at a maximum period of five months. Physical-mechanical testing were compressive strength and ultrasonic pulse velocity (UPV). Although presenting good mechanical performance, the mortar based on ash (RHA) did not present pozolanicity but it can be employed in cement matrices as inert material (filler).

Sistema Nacional de Educação articulado ao Plano Nacional de Educação

This text which discusses the central theme of the National Conference on Education (CONAE), held in Brasília from 28th March to 1st April 2010, deals with the concept of a National System of Education in articulation with the National Plan of Education. To that end, after pointing to the basic uses of the concept of system, it discusses the question of the National System of Education exploring the federative question in order to reveal the complete compatibility of the organization of the National System of Education with the federative regime. Thereafter, it deals with the historical meaning of the National Plan of Education demonstrating that the plan is a demand of the system, since planned action is implicit in systematized education. Thus the National Plan of Education is fulfilling those goals and objectives for which it is responsible.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

A moradia estudantil universitária como tema na produção científica nacional

This study analyses the national scientific production about college students' residence halls. The country's main data bases and electronic sites of several Brazilian higher education institutions were checked and 23 studies, published between 2000 and 2009, were found. The results of our analysis point to different focuses, which can be grouped into three categories: students who live in residence halls, residence halls themselves and actions for student assistance. Although there is large foreign scientific production about college student housing, the national production on this theme is still scarce, and the idea of student residence halls as educational spaces is still very incipient. The study points out to the need for investigating the living conditions in these places, and the impacts of this kind of habitation on students. Considering that student housing is an institutional responsibility, these studies potentially subsidize measures for proper educational conditions for college students.

Pedagogia de esporte : aspectos motriz de aprendizagem em hoquei em patins, crianças de oito a dez anos

Universidade Estadual de Campinas. Faculdade de Educação Física

A visão estrategico-tatica de tecnicos campeões da Liga Nacional de Futsal

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise do desenvolvimento das praticas urbanas de lazer relacionadas a produção cultural no periodo nacional-desenvolvimentista a globalização atraves da Teoria da Ação Comunicativa

Universidade Estadual de Campinas . Faculdade de Educação Física

Escola Nacional de Educação Fisica e Desportos : uma possivel historia

Universidade Estadual de Campinas . Faculdade de Educação Física

Mudanças nas variaveis de aptidão fisica numa equipe de futebol da 1ª divisão do campeonato nacional durante uma pre-temporada

Universidade Estadual de Campinas . Faculdade de Educação Física