Quantificação de fluxos de mercúrio gasoso na interface solo/atmosfera utilizando câmara de fluxo dinâmica: aplicação na bacia do Rio Negro

Gaseous mercury sampling conditions were optimized and a dynamic flux chamber was used to measure the air/surface exchange of mercury in some areas of the Negro river basin with different vegetal coverings. At the two forest sites (flooding and non-flooding), low mercury fluxes were observed: maximum of 3 pmol m-2 h-1 - day and minimum of -1 pmol m-2 h-1 - night. At the deforested site, the mercury fluxes were higher and always positive: maximum of 26 pmol m-2 h-1 - day and 17 pmol m-2 h-1 - night. Our results showed that deforestation could be responsible for significantly increasing soil Hg emissions, mainly because of the high soil temperatures reached at deforested sites.

Amostragem e variabilidade espacial de atributos químicos do solo em área de vegetação natural em regeneração

The objectives of this work was to estimate the number of soil subsamples considering the classical statistics and geostatistics and determine the spatial variability of soil fertility attributes of an Ultisol, with clay texture, in an area of regenerating natural vegetation in Alegre - ES. Soil samples were collected in a depth of 0.0-0.2 m, at the crossing points of a regular grid, comprising a total of 64 points located at 10 m-intervals. The area presented low fertility soil. Considering a variation of 5% around the mean in the classic statistics, it is necessary a larger number of samples in relation to geostatistics. All the chemical attributes showed moderate to high spatial dependence, except for the effective cation exchange capacity (CECe), which showed pure nugget effect. The spherical semivariogram model gave the best fit to the data. Isoline maps allowed visualizing the differentiated spatial distribution of the contents of soil chemical attributes.

Métodos probabilístico e determinístico para diagnóstico da necessidade de subsolagem de solos agrícolas

This paper presents two techniques to evaluate soil mechanical resistance to penetration as an auxiliary method to help in a decision-making in subsoiling operations. The decision is based on the volume of soil mobilized as a function of the considered critical soil resistance to penetration in each case. The first method, probabilistic, uses statistical techniques to define the volume of soil to be mobilized. The other method, deterministic, determines the percentage of soil to be mobilized and its spatial distribution. Both cases plot the percentage curves of experimental data related to the soil mechanical resistance to penetration equal or larger to the established critical level and the volume of soil to be mobilized as a function of critical level. The deterministic method plots showed the spatial distribution of the data with resistance to penetration equal or large than the critical level. The comparison between mobilized soil curves as a function of critical level using both methods showed that they can be considered equivalent. The deterministic method has the advantage of showing the spatial distribution of the critical points.

Características físicas e mecânicas de misturas de solo, cimento e cinzas de bagaço de cana-de-açúcar

This work was done with the objective of studying some physical and mechanical characteristics of the sugarcane bagasse ash added to a soil-cement mixture, in order to obtain an alternative construction material. The sugarcane bagasse ash pre-treatment included both sieving and grinding, before mixing with soil and cement. Different proportions of cement-ash were tested by determining its standard consistence and its compressive resistance at 7 and 28 days age. The various treatments were subsequently applied to the specimens molded with different soil-cement-ash mixtures which in turns were submitted to compaction, unconfined compression and water absorption laboratory tests. The results showed that it is possible to replace up to 20% of Portland cement by sugarcane bagasse ash without any damage to the mixture's compressive strength.

Modelo dinâmico de simulação e otimização da força normal de reação do solo para um mecanismo de corte basal

The physical model was based on the method of Newton-Euler. The model was developed by using the scientific computer program Mathematica®. Several simulations where tried varying the progress speeds (0.69; 1.12; 1.48; 1.82 and 2.12 m s-1); soil profiles (sinoidal, ascending and descending ramp) and height of the profile (0.025 and 0.05 m) to obtain the normal force of soil reaction. After the initial simulations, the mechanism was optimized using the scientific computer program Matlab® having as criterion (function-objective) the minimization of the normal force of reaction of the profile (FN). The project variables were the lengths of the bars (L1y, L2, l3 and L4), height of the operation (L7), the initial length of the spring (Lmo) and the elastic constant of the spring (k t). The lack of robustness of the mechanism in relation to the variable height of the operation was outlined by using a spring with low rigidity and large length. The results demonstrated that the mechanism optimized showed better flotation performance in relation to the initial mechanism.

Efeitos da cobertura do solo com filme de polietileno azul no consumo de água da cultura da alface cultivada em estufa

The covering of the soil is an agricultural practice that intends to control the harmful herbs, to reduce the losses of water by evaporation of the soil, and to facilitate the harvest and the commercialization, once the product is cleaner and healthier. However, when the soil is covered important microclimatic parameters are also altered, and consequently the germination of seeds, the growth of roots, the absorption of water and nutrients, the metabolic activity of the plants and the carbohydrates storage. The current trial intended to evaluate the effect of soil covering with blue colored film on consumptive water-use in a lettuce crop (Lactuca sativa, L.). The experiment was carried out in a plastic greenhouse in Araras - São Paulo State, Brazil from March 3rd, 2001 to May 5th, 2001. The consumptive water-use was measured through two weighing lysimeter installed inside the greenhouse. Crop spacing was 0.25 m x 0.25 m and the color of the film above soil was blue. Leaf area index (IAF), was measured six times (7; 14; 21; 28; 35; 40 days after transplant) and the water-use efficiency (EU) was measured at the end. The experimental design was subdivided portions with two treatments, bare soil and covered soil. The average consumptive water-use was 4.17 mm day-1 to the bare soil treatment and 3.11 mm day-1 to the covered soil treatment. The final leaf area index was 25.23 to the bare soil treatment and 24.39 to the covered soil treatment, and there was no statistical difference between then.

Características físicas e mecânicas de misturas de solo, cimento e casca de arroz

The main objective of this work is the study of the effect of rice husk addition on the physical and mechanical properties of soil-cement, in order to obtain an alternative construction material. The rice husk preparation consisted of grinding, sieving, and the pre-treatment with lime solution. The physical characteristics of the soil and of the rice husk were determined. Different amounts of soil, cement and rice husk were tested by compaction and unconfined compression. The specimens molded according to the treatments applied to the mixtures were subsequently submitted to compression testing and to tensile splitting cylinder testing at 7 and 28 days of age and to water absorption testing. After determining its physical and mechanical characteristics, the best results were obtained for the soil + 12% (cement + rice husk) mixture. The results showed a promising use as an alternative construction material.

Calibração da Reflectometria no Domínio do Tempo (TDR) para a estimativa da concentração da solução no solo

Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.

Variabilidade espacial de atributos físicos de um argissolo vermelho-amarelo sob pastagem e vegetação secundária em regeneração natural

This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.

Fundações de construções submetidas a esforços de tração em solo de alta porosidade da região de Campinas - SP

This paper presents the behavior of three bored piles conducted in diabasic soil submitted to uplift forces. The piles were built at the site for Experimental Studies in Soil Mechanics and Foundations of UNICAMP, located in the city of Campinas, Brazil. Field tests have already been conducted at the site (SPT, CPT, DMT and PMT), as well as laboratory tests by using sample soils taken from a well up to 17 m deep. The water table is not checked until a depth of 17 m. In order to check the behavior of the piles when submitted to uplift forces, slow static load tests were carried out as the recommendations of NBR 12131. The carrying capacity of these piles was also provided by means of theoretical methods, appropriate for uplift forces, and through semi-empirical methods appropriate for compression forces, considering only the portion of lateral resistance. The values estimated by using the considered methods were compared to those obtained by means of load tests. One of the tested piles was extracted from the soil to be the subject of a study on its geometry.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.