Interictal hyposexuality in male patients with epilepsy

The purpose of this study was to compare the serum levels of androgens between hyposexual and non-hyposexual patients with epilepsy. Adult male patients with epilepsy were investigated. Serum levels of testosterone (T) and free-T, estradiol, and sex hormone binding globulin (SHBG) were measured and the free androgen index (FAI) was calculated. While there were no differences between hyposexual and non-hyposexual patients in the serum levels of T, free-T, and estradiol, or to the FAI, the serum levels of SHBG were significantly higher in hyposexual patients than in non-hyposexual patients. Thus, the effects of increased SHBG upon serum levels of testosterone biologically active in patients with epilepsy and hyposexuality were not detected by the methods used in this study. Four (44%) of nine hyposexual patients who were re-evaluated after two years follow-up improved sexual performance. Thus, clinical treatment that results in good seizure control may improve sexual performance in some patients with epilepsy.

A COMPETÊNCIA LEXICAL DE ALUNOS UNIVERSITÁRIOS APRENDENDO A LER EM INGLÊS COMO LÍNGUA ESTRANGEIRA

This article presents a characterization of the lexical competence (vocabulary knowledge and use) of students learning to read in EFL in a public university in São Paulo state. Although vocabulary has been consistently cited as one of the EFL reader´s main source of difficulty, there is no data in the literature which shows the extent of the difficulties. The data for this study is part of a previous research, which investigates, from the perspective of an interactive model of reading, the relationship between lexical competence and EFL reading comprehension. Quantitative as well as qualitative data was considered. For this study, the quantitative data is the product of vocabulary tests of 49 subjects while the qualitative data comprises pause protocols of three subjects, with levels of reading ability ranging from good to poor, selected upon their performance in the quantitative study. A rich concept of vocabulary knowledge was adapted and used for the development of vocabulary tests and analysis of protocols. The results on both studies show, with a few exceptions, the lexical competence of the group to be vague and imprecise in two dimensions: quantitative (number of known words or vocabulary size) and qualitative (depth or width of this knowledge). Implications for the teaching of reading in a foreign context are discussed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para analise cinematica de volumes respiratorios parciais de nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia de esporte : aspectos motriz de aprendizagem em hoquei em patins, crianças de oito a dez anos

Universidade Estadual de Campinas. Faculdade de Educação Física

Avaliações autonômicas e cardiovasculares em pessoas com lesão da medula espinhal nas situações de repouso, em um teste de estresse mental e durante exercício físico

Universidade Estadual de Campinas . Faculdade de Educação Física

Calibração de câmeras para análises subaquáticas de movimentos = : Cameras calibration for underwater motion analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito residual no triathlon : como nadar influência nas etapas seguintes

Universidade Estadual de Campinas. Faculdade de Educação Física

Estudo do salto vertical : uma analise da relação de forças aplicadas

Universidade Estadual de Campinas. Faculdade de Educação Física