11 resultados para Oxford Readings in Classical Studies. Aeschylus
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.
Resumo:
The genera Cochliomyia and Chrysomya contain both obligate and saprophagous flies, which allows the comparison of different feeding habits between closely related species. Among the different strategies for comparing these habits is the use of qPCR to investigate the expression levels of candidate genes involved in feeding behavior. To ensure an accurate measure of the levels of gene expression, it is necessary to normalize the amount of the target gene with the amount of a reference gene having a stable expression across the compared species. Since there is no universal gene that can be used as a reference in functional studies, candidate genes for qPCR data normalization were selected and validated in three Calliphoridae (Diptera) species, Cochliomyia hominivorax Coquerel, Cochliomyia macellaria Fabricius, and Chrysomya albiceps Wiedemann . The expression stability of six genes ( Actin, Gapdh, Rp49, Rps17, α -tubulin, and GstD1) was evaluated among species within the same life stage and between life stages within each species. The expression levels of Actin, Gapdh, and Rp49 were the most stable among the selected genes. These genes can be used as reliable reference genes for functional studies in Calliphoridae using similar experimental settings.
Resumo:
In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.
Resumo:
Otorhinolaryngological manifestations of rheumatologic diseases represent a great challenge not only to the generalistphysician but also to the ENT doctor andrheumatologist. They often represent early manifestations of an autoimmune disorder which requires prompt and aggressive immunosuppressive treatment. Auditory, nasal, laryngeal and eye symptoms can be the first manifestation of rheumatic diseases and their proper assessment helps the doctor to identify signs of disease activity. The objective of this study is to identify the ENT manifestations in patients with rheumatic diseases in a high complexity hospital, regarding facilitating an early diagnosis and treatment. We performed clinical and complete otorhinolaryngological evaluations in patients selected from the outpatient rheumatology in a standardized manner by the use of a standardized form filling during the secondhalf of 2010. In the study group, systemic lupus erythematosus (SLE) patients had predominantly laryngeal manifestations, while patients with Sjögren's syndrome showed a higher prevalence of otologic manifestations. Changes in audiometric tests were found in 53% of Wegener's granulomatosis (WG) patients, 80% of relapsing polychondritis (RP), 33% of systemic lupus erythematosus (SLE) and 50% of Churg-Strauss syndrome (SCS). Regarding nasal alterations, these were found so prevalent in all conditions, especially Churg-Strauss syndrome. This study demonstrated that most patients treated in our hospital has the ENT signs and symptoms commonly associated in previous studies on rheumatic diseases, but further studies with a larger number of patients must be made to establish such relations.
Resumo:
Herein we describe the synthesis of a focused library of compounds based on the structure of goniothalamin (1) and the evaluation of the potential antitumor activity of the compounds. N-Acylation of aza-goniothalamin (2) restored the in vitro antiproliferative activity of this family of compounds. 1-(E)-But-2-enoyl-6-styryl-5,6-dihydropyridin-2(1H)-one (18) displayed enhanced antiproliferative activity. Both goniothalamin (1) and derivative 18 led to reactive oxygen species generation in PC-3 cells, which was probably a signal for caspase-dependent apoptosis. Treatment with derivative 18 promoted Annexin V/7-aminoactinomycin D double staining, which indicated apoptosis, and also led to G2 /M cell-cycle arrest. In vivo studies in Ehrlich ascitic and solid tumor models confirmed the antitumor activity of goniothalamin (1), without signs of toxicity. However, derivative 18 exhibited an unexpectedly lower in vivo antitumor activity, despite the treatments being administered at the same site of inoculation. Contrary to its in vitro profile, aza-goniothalamin (2) inhibited Ehrlich tumor growth, both on the ascitic and solid forms. Our findings highlight the importance of in vivo studies in the search for new candidates for cancer treatment.
Resumo:
Primary craniocervical dystonia (CCD) is generally attributed to functional abnormalities in the cortico-striato-pallido-thalamocortical loops, but cerebellar pathways have also been implicated in neuroimaging studies. Hence, our purpose was to perform a volumetric evaluation of the infratentorial structures in CCD. We compared 35 DYT1/DYT6 negative patients with CCD and 35 healthy controls. Cerebellar volume was evaluated using manual volumetry (DISPLAY software) and infratentorial volume by voxel based morphometry of gray matter (GM) segments derived from T1 weighted 3 T MRI using the SUIT tool (SPM8/Dartel). We used t-tests to compare infratentorial volumes between groups. Cerebellar volume was (1.14 ± 0.17) × 10(2) cm(3) for controls and (1.13 ± 0.14) × 10(2) cm(3) for patients; p = 0.74. VBM demonstrated GM increase in the left I-IV cerebellar lobules and GM decrease in the left lobules VI and Crus I and in the right lobules VI, Crus I and VIIIb. In a secondary analysis, VBM demonstrated GM increase also in the brainstem, mostly in the pons. While gray matter increase is observed in the anterior lobe of the cerebellum and in the brainstem, the atrophy is concentrated in the posterior lobe of the cerebellum, demonstrating a differential pattern of infratentorial involvement in CCD. This study shows subtle structural abnormalities of the cerebellum and brainstem in primary CCD.
Resumo:
Resistant hypertension (RHTN) is a multifactorial disease characterized by blood pressure (BP) levels above goal (140/90 mmHg) in spite of the concurrent use of three or more antihypertensive drugs of different classes. Moreover, it is well known that RHTN subjects have high prevalence of left ventricular diastolic dysfunction (LVDD), which leads to increased risk of heart failure progression. This review gathers data from studies evaluating the effects of phosphodiesterase-5 (PDE-5) inhibitors (administration of acute sildenafil and short-term tadalafil) on diastolic function, biochemical and hemodynamic parameters in patients with RHTN. Acute study with sildenafil treatment found that inhibition of PDE-5 improved hemodynamic parameters and diastolic relaxation. In addition, short-term study with the use of tadalafil demonstrated improvement of LVDD, cGMP and BNP-32 levels, regardless of BP reduction. No endothelial function changes were observed in the studies. The findings of acute and short-term studies revealed potential therapeutic effects of IPDE-5 drugs on LVDD in RHTN patients.A Hipertensão arterial resistente (HAR) é uma doença multifatorial caracterizada por níveis pressóricos acima das metas (140/90 mmHg), a despeito de tratamento farmacológico otimizado de 3 ou mais fármacos anti-hipertensivos de diferentes classes. Pacientes diagnosticados como hipertensos resistentes apresentam alta prevalência de disfunção diastólica do ventrículo esquerdo (DDVE) que proporciona risco aumentado para insuficiência cardíaca. Esta revisão reúne dados de estudos prévios avaliando os efeitos dos inibidores de fosfodiesterase-5 (PDE-5) (administração aguda de sildenafil e de curto prazo de tadalafil) na função diastólica e nos parâmetros bioquímicos e hemodinâmicos em pacientes com HAR. O estudo agudo com sildenafil demonstrou que a inibição da PDE-5 melhorou os parâmetros hemodinâmicos e de relaxamento diastólico. Além disso, o estudo curto prazo com o uso de tadalafil revelou melhora da DDVE e dos níveis de GMPc e BNP-32, independente de redução de pressão arterial. A função endotelial não apresentou alteração com ambos os tratamentos. Os resultados dos estudos agudo e de curto prazo sugerem efeitos terapêuticos potenciais dos fármacos inibidores da PDE-5 na disfunção diastólica em pacientes com HAR.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física