34 resultados para Object-Specific Authorization Protocol

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Protocols for the generation of dendritic cells (DCs) using serum as a supplementation of culture media leads to reactions due to animal proteins and disease transmissions. Several types of serum-free media (SFM), based on good manufacture practices (GMP), have recently been used and seem to be a viable option. The aim of this study was to evaluate the results of the differentiation, maturation, and function of DCs from Acute Myeloid Leukemia patients (AML), generated in SFM and medium supplemented with autologous serum (AS). DCs were analyzed by phenotype characteristics, viability, and functionality. The results showed the possibility of generating viable DCs in all the conditions tested. In patients, the X-VIVO 15 medium was more efficient than the other media tested in the generation of DCs producing IL-12p70 (p=0.05). Moreover, the presence of AS led to a significant increase of IL-10 by DCs as compared with CellGro (p=0.05) and X-Vivo15 (p=0.05) media, both in patients and donors. We concluded that SFM was efficient in the production of DCs for immunotherapy in AML patients. However, the use of AS appears to interfere with the functional capacity of the generated DCs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Diabetic Retinopathy (DR) is a complication of diabetes that can lead to blindness if not readily discovered. Automated screening algorithms have the potential to improve identification of patients who need further medical attention. However, the identification of lesions must be accurate to be useful for clinical application. The bag-of-visual-words (BoVW) algorithm employs a maximum-margin classifier in a flexible framework that is able to detect the most common DR-related lesions such as microaneurysms, cotton-wool spots and hard exudates. BoVW allows to bypass the need for pre- and post-processing of the retinographic images, as well as the need of specific ad hoc techniques for identification of each type of lesion. An extensive evaluation of the BoVW model, using three large retinograph datasets (DR1, DR2 and Messidor) with different resolution and collected by different healthcare personnel, was performed. The results demonstrate that the BoVW classification approach can identify different lesions within an image without having to utilize different algorithms for each lesion reducing processing time and providing a more flexible diagnostic system. Our BoVW scheme is based on sparse low-level feature detection with a Speeded-Up Robust Features (SURF) local descriptor, and mid-level features based on semi-soft coding with max pooling. The best BoVW representation for retinal image classification was an area under the receiver operating characteristic curve (AUC-ROC) of 97.8% (exudates) and 93.5% (red lesions), applying a cross-dataset validation protocol. To assess the accuracy for detecting cases that require referral within one year, the sparse extraction technique associated with semi-soft coding and max pooling obtained an AUC of 94.2 ± 2.0%, outperforming current methods. Those results indicate that, for retinal image classification tasks in clinical practice, BoVW is equal and, in some instances, surpasses results obtained using dense detection (widely believed to be the best choice in many vision problems) for the low-level descriptors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A literature review was conducted aiming to understand the interface between the Intellectual Disability and Mental Health fields and to contribute to mitigating the path of institutionalizing individuals with intellectual deficiencies. The so-called dual diagnosis phenomenon remains underestimated in Brazil but is the object of research and specific public policy internationally. This phenomenon alerts us to the prevalence of mental health problems in those with intellectual disabilities, limiting their social inclusion. The findings reinforce the importance of this theme and indicate possible diagnostic invisibility of the development of mental illness in those with intellectual disabilities in Brazil, which may contribute to sustaining psychiatric institutionalization of this population. 

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate the effects of a specific protocol of undulatory physical resistance training on maximal strength gains in elderly type 2 diabetics. The study included 48 subjects, aged between 60 and 85 years, of both genders. They were divided into two groups: Untrained Diabetic Elderly (n=19) with those who were not subjected to physical training and Trained Diabetic Elderly (n=29), with those who were subjected to undulatory physical resistance training. The participants were evaluated with several types of resistance training's equipment before and after training protocol, by test of one maximal repetition. The subjects were trained on undulatory resistance three times per week for a period of 16 weeks. The overload used in undulatory resistance training was equivalent to 50% of one maximal repetition and 70% of one maximal repetition, alternating weekly. Statistical analysis revealed significant differences (p<0.05) between pre-test and post-test over a period of 16 weeks. The average gains in strength were 43.20% (knee extension), 65.00% (knee flexion), 27.80% (supine sitting machine), 31.00% (rowing sitting), 43.90% (biceps pulley), and 21.10% (triceps pulley). Undulatory resistance training used with weekly different overloads was effective to provide significant gains in maximum strength in elderly type 2 diabetic individuals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Endurance exercise training as well as leucine supplementation modulates glucose homeostasis and protein turnover in mammals. Here, we analyze whether leucine supplementation alters the effects of endurance exercise on these parameters in healthy mice. Mice were distributed into sedentary (C) and exercise (T) groups. The exercise group performed a 12-week swimming protocol. Half of the C and T mice, designated as the CL and TL groups, were supplemented with leucine (1.5 % dissolved in the drinking water) throughout the experiment. As well known, endurance exercise training reduced body weight and the retroperitoneal fat pad, increased soleus mass, increased VO2max, decreased muscle proteolysis, and ameliorated peripheral insulin sensitivity. Leucine supplementation had no effect on any of these parameters and worsened glucose tolerance in both CL and TL mice. In the soleus muscle of the T group, AS-160(Thr-642) (AKT substrate of 160 kDa) and AMPK(Thr-172) (AMP-Activated Protein Kinase) phosphorylation was increased by exercise in both basal and insulin-stimulated conditions, but it was reduced in TL mice with insulin stimulation compared with the T group. Akt phosphorylation was not affected by exercise but was lower in the CL group compared with the other groups. Leucine supplementation increased mTOR phosphorylation at basal conditions, whereas exercise reduced it in the presence of insulin, despite no alterations in protein synthesis. In trained groups, the total FoxO3a protein content and the mRNA for the specific isoforms E2 and E3 ligases were reduced. In conclusion, leucine supplementation did not potentiate the effects of endurance training on protein turnover, and it also reduced its positive effects on glucose homeostasis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Matrix-assisted laser desorption/ionization time-of flight mass spectrometry (MALDI-TOF MS) has been widely used for the identification and classification of microorganisms based on their proteomic fingerprints. However, the use of MALDI-TOF MS in plant research has been very limited. In the present study, a first protocol is proposed for metabolic fingerprinting by MALDI-TOF MS using three different MALDI matrices with subsequent multivariate data analysis by in-house algorithms implemented in the R environment for the taxonomic classification of plants from different genera, families and orders. By merging the data acquired with different matrices, different ionization modes and using careful algorithms and parameter selection, we demonstrate that a close taxonomic classification can be achieved based on plant metabolic fingerprints, with 92% similarity to the taxonomic classifications found in literature. The present work therefore highlights the great potential of applying MALDI-TOF MS for the taxonomic classification of plants and, furthermore, provides a preliminary foundation for future research.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemical industries worldwide are passing through a very particular moment of re-adaptation due to the implementation of an European regulation called, Registration, Evaluation, Authorization and Restriction of Chemicals (REACH). In Brazil, the Brazilian Chemical Industry needs urgently a specific guide of chemical products stability. The main purpose of this work is to present a proposal of a guide of stability for chemical products based on the reference guides of the International Conference on Harmonization (ICH). Thus, this work proposes an innovation in terms of methodology which will be useful for shelf life definition purpose for chemical industry products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work presents the development of low cost microprocessor-based equipment for generation of differential GPS correction signal, in real time, and configuration and supervision of the GPS base. The developed equipment contains a dedicated microcontroller connected to the GPS receiver, alphanumeric display and multifunction keyboard for configuration and operation of the system and communication interfaces. The electronic circuit has the function of receiving the information from GPS base; interpret them, converting the sentence in the RTCM SC-104 protocol. The microcontroller software makes the conversion of the signal received by the GPS base from the specific format to RTCM SC-104 protocol. The processing main board has two serials RS-232C standard interfaces. One of them is used for configuration and receiving the information generated by the GPS base. The other operates as output, sending the differential correction signal for the transmission system. The development of microprocessor-based equipment showed that it is possible the construction of a low cost private station for real time generation of differential GPS correction signal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física