A pratica de exercicios resistidos por pessoas com esclerose multipla

Universidade Estadual de Campinas . Faculdade de Educação Física

Adesão de linhagem selvagem de Streptococcus thermophilus em superfície de aço inoxidável e efeitos da higienização na sua remoção

A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Qualidade de vida de portadores de Diabetes Mellitus tipo II frente às oscilações no nível de atividade física, aspectos socioeconômicos e presença de comorbidades

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise cinemática tridimensional do salto em distância de atletas de alto nível em competição

Universidade Estadual de Campinas . Faculdade de Educação Física

Survey regional sobre crescimento e desenvolvimento : relações com maturação, sobrepeso e obesidade, nível socioeconômico e desempenho motor

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação da associação de diferentes programas de atividade física aplicados no local de trabalho sobre o nível de atividade física e qualidade de vida de trabalhadores do setor administrativo de comunidade universitária

Universidade Estadual de Campinas . Faculdade de Educação Física