12 resultados para Multiple Stages
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The cerebellum is an important site for cortical demyelination in multiple sclerosis, but the functional significance of this finding is not fully understood. To evaluate the clinical and cognitive impact of cerebellar grey-matter pathology in multiple sclerosis patients. Forty-two relapsing-remitting multiple sclerosis patients and 30 controls underwent clinical assessment including the Multiple Sclerosis Functional Composite, Expanded Disability Status Scale (EDSS) and cerebellar functional system (FS) score, and cognitive evaluation, including the Paced Auditory Serial Addition Test (PASAT) and the Symbol-Digit Modalities Test (SDMT). Magnetic resonance imaging was performed with a 3T scanner and variables of interest were: brain white-matter and cortical lesion load, cerebellar intracortical and leukocortical lesion volumes, and brain cortical and cerebellar white-matter and grey-matter volumes. After multivariate analysis high burden of cerebellar intracortical lesions was the only predictor for the EDSS (p<0.001), cerebellar FS (p = 0.002), arm function (p = 0.049), and for leg function (p<0.001). Patients with high burden of cerebellar leukocortical lesions had lower PASAT scores (p = 0.013), while patients with greater volumes of cerebellar intracortical lesions had worse SDMT scores (p = 0.015). Cerebellar grey-matter pathology is widely present and contributes to clinical dysfunction in relapsing-remitting multiple sclerosis patients, independently of brain grey-matter damage.
Resumo:
Desmoid tumor (DT) is a common manifestation of Gardner's Syndrome (GS), although it is a rare condition in the general population. DT in patients with GS is usually located in the abdominal wall and/or intra-abdominal cavity. We report a case of a 32 years-old female patient with familial adenomatous polyposis (FAP), who was already submitted to total colectomy and developed multiple DT, located in the abdominal wall and in the left breast. The patient underwent several surgical procedures, with a multidisciplinary team of surgeons. Wide surgical resections of the left breast and the abdominal wall tumors were performed in separate steps. Polypropylene mesh reconstruction and muscle flaps were needed to cover the defects of the thoracic and abdominal walls. After partial necrosis of the adipose-cutaneous flap in the abdomen that required a new skin graft, she had a satisfactory outcome with complete healing of the surgical incisions. DT is frequent in GS, however, breast localization is very rare, with few cases reported in the literature. Recurrence of DT is not negligible, even after a wide surgical resection. GS patients must be followed up closely, and clinical examination, associated with imaging studies, should be performed to detect any signs of tumor. DT represents one of the most significant causes of the morbidity and mortality that affects FAP patients following colectomy. In general, the surgical procedures to excise DT are highly complex, requiring a multidisciplinary team.
Resumo:
Sexual dysfunction (SD) affects up to 80% of multiple sclerosis (MS) patients and pelvic floor muscles (PFMs) play an important role in the sexual function of these patients. The objective of this paper is to evaluate the impact of a rehabilitation program to treat lower urinary tract symptoms on SD of women with MS. Thirty MS women were randomly allocated to one of three groups: pelvic floor muscle training (PFMT) with electromyographic (EMG) biofeedback and sham neuromuscular electrostimulation (NMES) (Group I), PFMT with EMG biofeedback and intravaginal NMES (Group II), and PFMT with EMG biofeedback and transcutaneous tibial nerve stimulation (TTNS) (Group III). Assessments, before and after the treatment, included: PFM function, PFM tone, flexibility of the vaginal opening and ability to relax the PFMs, and the Female Sexual Function Index (FSFI) questionnaire. After treatment, all groups showed improvements in all domains of the PERFECT scheme. PFM tone and flexibility of the vaginal opening was lower after the intervention only for Group II. All groups improved in arousal, lubrication, satisfaction and total score domains of the FSFI questionnaire. This study indicates that PFMT alone or in combination with intravaginal NMES or TTNS contributes to the improvement of SD.
Resumo:
346
Resumo:
Fingolimod is a new and efficient treatment for multiple sclerosis (MS). The drug administration requires special attention to the first dose, since cardiovascular adverse events can be observed during the initial six hours of fingolimod ingestion. The present study consisted of a review of cardiovascular data on 180 patients with MS receiving the first dose of fingolimod. The rate of bradycardia in these patients was higher than that observed in clinical trials with very strict inclusion criteria for patients. There were less than 10% of cases requiring special attention, but no fatal cases. All but one patient continued the treatment after this initial dose. This is the first report on real-life administration of fingolimod to Brazilian patients with MS, and one of the few studies with these characteristics in the world.
Resumo:
Palpable mass is a common complaint presented to the breast surgeon. It is very uncommon for patients to report breast mass associated with palpable masses in other superficial structures. When these masses are related to systemic granulomatous diseases, the diagnosis and initiation of specific therapy can be challenging. The purpose of this paper is to report a case initially assessed by the breast surgeon and ultimately diagnosed as granulomatous variant of T-cell lymphoma, and discuss the main systemic granulomatous diseases associated with palpable masses involving the breast.
Resumo:
Multiple sclerosis, which is the most common cause of chronic neurological disability in young adults, is an inflammatory, demyelinating, and neurodegenerative disease of the CNS, which leads to the formation of multiple foci of demyelinated lesions in the white matter. The diagnosis is based currently on magnetic resonance image and evidence of dissemination in time and space. However, this could be facilitated if biomarkers were available to rule out other disorders with similar symptoms as well as to avoid cerebrospinal fluid analysis, which requires an invasive collection. Additionally, the molecular mechanisms of the disease are not completely elucidated, especially those related to the neurodegenerative aspects of the disease. The identification of biomarker candidates and molecular mechanisms of multiple sclerosis may be approached by proteomics. In the last 10 years, proteomic techniques have been applied in different biological samples (CNS tissue, cerebrospinal fluid, and blood) from multiple sclerosis patients and in its experimental model. In this review, we summarize these data, presenting their value to the current knowledge of the disease mechanisms, as well as their importance in identifying biomarkers or treatment targets.
Resumo:
ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física