Dos conceitos de morte aos critérios para o diagnóstico de morte encefálica

The authors present considerations about death and brain death concepts, as well the legal aspects for its diagnosis in Brazil. They also present the UNICAMP Protocol for the Diagnosis of Brain Death, revised and according with the current law, with standard techniques for the diagnostic exam. They emphasize the importance of a mature ethical position for this frequent and challenging situation.

Vasopressina e morte encefálica

Brain death results in the breakdown of effective central regulatory mechanisms of cardiocirculatory stability, even in patients with artificial mechanical ventilation, correction of electrolytic and acid-basic disorders and maximal conventional pharmacological support of the circulation. Recent evidences have shown that the fall of vasopressin levels in the blood circulation significantly influences the cardiocirculatory stability of patients with brain death, and its exogenous administration is defended by many authors for the management of multiorgan donor patients. In this brief review we analyse and discuss some experimental and clinical relevant studies about the role of vasopressin in the control of cardiocirculatory stability in brain death, and its potential usefulness in the management of multiorgan donor. We conclude that the role of vasopressin in the pathophysiology of brain death and its usefulness as a pharmacological agent in the management of multiorgan donor are not well elucidated, deserving further investigations.

Evolution Of The Deaths Registry System In Brazil: Associations With Changes In The Mortality Profile, Under-registration Of Death Counts, And Ill-defined Causes Of Death.

This paper examines the spatial pattern of ill-defined causes of death across Brazilian regions, and its relationship with the evolution of completeness of the deaths registry and changes in the mortality age profile. We make use of the Brazilian Health Informatics Department mortality database and population censuses from 1980 to 2010. We applied demographic methods to evaluate the quality of mortality data for 137 small areas and correct for under-registration of death counts when necessary. The second part of the analysis uses linear regression models to investigate the relationship between, on the one hand, changes in death counts coverage and age profile of mortality, and on the other, changes in the reporting of ill-defined causes of death. The completeness of death counts coverage increases from about 80% in 1980-1991 to over 95% in 2000-2010 at the same time the percentage of ill-defined causes of deaths reduced about 53% in the country. The analysis suggests that the government's efforts to improve data quality are proving successful, and they will allow for a better understanding of the dynamics of health and the mortality transition.

Nek5 Interacts With Mitochondrial Proteins And Interferes Negatively In Mitochondrial Mediated Cell Death And Respiration.

Mitochondria are involved in energy supply, signaling, cell death and cellular differentiation and have been implicated in several human diseases. Neks (NIMA-related kinases) represent a family of mammal protein kinases that play essential roles in cell-cycle progression, but other functions have recently been related. A yeast two-hybrid (Y2H) screen was performed to identify and characterize Nek5 interaction partners and the mitochondrial proteins Cox11, MTX-2 and BCLAF1 were retrieved. Apoptosis assay showed protective effects of stable hNek5 expression from Hek293-T's cell death after thapsigargin treatment (2μM). Nek5 silenced cells as well as cells expressing a kinase dead version of Nek5, displayed an increase in ROS formation after 4h of thapsigargin treatment. Mitochondrial respiratory chain activity was found decreased upon stable hNek5expression. Cells silenced for hNek5 on the other hand presented 1.7 fold increased basal rates of respiration, especially at the electrons transfer steps from TMPD to cytochrome c and at the complex II. In conclusion, our data suggest for the first time mitochondrial localization and functions for Nek5 and its participation in cell death and cell respiration regulation. Stable expression of hNek5 in Hek293T cells resulted in enhanced cell viability, decreased cell death and drug resistance, while depletion of hNek5by shRNA overcame cancer cell drug resistance and induced apoptosis in vitro. Stable expression of hNek5 also inhibits thapsigargin promoted apoptosis and the respiratory chain complex IV in HEK293T cells.

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study.

To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity. Multicenter cross-sectional study. Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010. A total of 9555 women categorized as having obstetric complications. The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women. The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome. Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death). Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.

Aplicação do escore MELD em pacientes submetidos a transplante de fígado: análise retrospectiva da sobrevida e dos fatores preditivos a curto e longo prazo

BACKGROUND: The model for end-stage liver disease (MELD) was developed to predict short-term mortality in patients with cirrhosis. There are few reports studying the correlation between MELD and long-term posttransplantation survival. AIM: To assess the value of pretransplant MELD in the prediction of posttransplant survival. METHODS: The adult patients (age >18 years) who underwent liver transplantation were examined in a retrospective longitudinal cohort of patients, through the prospective data base. We excluded acute liver failure, retransplantation and reduced or split-livers. The liver donors were evaluated according to: age, sex, weight, creatinine, bilirubin, sodium, aspartate aminotransferase, personal antecedents, brain death cause, steatosis, expanded criteria donor number and index donor risk. The recipients' data were: sex, age, weight, chronic hepatic disease, Child-Turcotte-Pugh points, pretransplant and initial MELD score, pretransplant creatinine clearance, sodium, cold and warm ischemia times, hospital length of stay, blood requirements, and alanine aminotransferase (ALT >1,000 UI/L = liver dysfunction). The Kaplan-Meier method with the log-rank test was used for the univariable analyses of posttransplant patient survival. For the multivariable analyses the Cox proportional hazard regression method with the stepwise procedure was used with stratifying sodium and MELD as variables. ROC curve was used to define area under the curve for MELD and Child-Turcotte-Pugh. RESULTS: A total of 232 patients with 10 years follow up were available. The MELD cutoff was 20 and Child-Turcotte-Pugh cutoff was 11.5. For MELD score > 20, the risk factors for death were: red cell requirements, liver dysfunction and donor's sodium. For the patients with hyponatremia the risk factors were: negative delta-MELD score, red cell requirements, liver dysfunction and donor's sodium. The regression univariated analyses came up with the following risk factors for death: score MELD > 25, blood requirements, recipient creatinine clearance pretransplant and age donor >50. After stepwise analyses, only red cell requirement was predictive. Patients with MELD score < 25 had a 68.86%, 50,44% and 41,50% chance for 1, 5 and 10-year survival and > 25 were 39.13%, 29.81% and 22.36% respectively. Patients without hyponatremia were 65.16%, 50.28% and 41,98% and with hyponatremia 44.44%, 34.28% and 28.57% respectively. Patients with IDR > 1.7 showed 53.7%, 27.71% and 13.85% and index donor risk <1.7 was 63.62%, 51.4% and 44.08%, respectively. Age donor > 50 years showed 38.4%, 26.21% and 13.1% and age donor <50 years showed 65.58%, 26.21% and 13.1%. Association with delta-MELD score did not show any significant difference. Expanded criteria donors were associated with primary non-function and severe liver dysfunction. Predictive factors for death were blood requirements, hyponatremia, liver dysfunction and donor's sodium. CONCLUSION: In conclusion MELD over 25, recipient's hyponatremia, blood requirements, donor's sodium were associated with poor survival.

Molecular diagnosis of Huntington disease in Brazilian patients

Huntington disease (HD) is a progressive neurodegenerative disorder with autosomal dominant inheritance, characterized by choreiform movements and cognitive impairment. Onset of symptoms is around 40 years of age and progression to death occurs in approximately 10 to 15 years from the time of disease onset. HD is associated with an unstable CAG repeat expansion at the 5' and of the IT15 gene. We have genotyped the CAG repeat in the IT15 gene in 44 Brazilian individuals (42 patients and 2 unaffected family members) belonging to 34 unrelated families thought to segregate HD. We found one expanded CAG allele in 32 individuals (76%) belonging to 25 unrelated families. In these HD patients, expanded alleles varied from 43 to 73 CAG units and normal alleles varied from 18 to 26 CAGs. A significant negative correlation between age at onset of symptoms and size of the expanded CAG allele was found (r=0.6; p=0.0001); however, the size of the expanded CAG repeat could explain only about 40% of the variability in age at onset (r2=0.4). In addition, we genotyped 25 unrelated control individuals (total of 50 alleles) and found normal CAG repeats varying from 16 to 33 units. The percentage of heterozigocity of the normal allele in the control population was 88%. In conclusion, our results showed that not all patients with the HD phenotype carried the expansion at the IT15 gene. Furthermore, molecular diagnosis was possible in all individuals, since no alleles of intermediate size were found. Therefore, molecular confirmation of the clinical diagnosis in HD should be sought in all suspected patients, making it possible for adequate genetic counseling.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Unusual branching in the palm Euterpe edulis Mart

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Candidíase sistêmica com localização encefálica: estudo anátomo-clínico de cinco casos

Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.

Polirradiculoneurite e malária: relato de um caso

Case report of a patient who three weeks after a Plasmodium falciparum malaria presented the Guillain-Barré syndrome. There was a severe type of polyradiculoneuritis with tetraplegia and involvement of several cranial nerves (VI, VII, IX, X) evolving to death. The Guillain-Barré syndrome has been considered a immune disorder with several eliciting antigenic stimuli. The case suggests that protozoan may be one these antigenic factors.

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica, saude coletiva e a luta do MST : reconstruindo relações a partir das violencias

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade fisica e a relação com a qualidade de vida, ansiedade e depressão em pessoas com sequelas de acidente vascular cerebral isquemico (AVCI)/ c Alberto Martins da Costa

Universidade Estadual de Campinas . Faculdade de Educação Física

Contribution Of Antepartum And Intrapartum Hemorrhage To The Burden Of Maternal Near Miss And Death In A National Surveillance Study

Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.