10 resultados para Level Independent Quasi-Birth-Death (LIQBD) Process
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
To compare neonatal deaths and complications in infants born at 34-36 weeks and six days (late preterm: LPT) with those born at term (37-41 weeks and six days); to compare deaths of early term (37-38 weeks) versus late term (39-41 weeks and six days) infants; to search for any temporal trend in LPT rate. A retrospective cohort study of live births was conducted in the Campinas State University, Brazil, from January 2004 to December 2010. Multiple pregnancies, malformations and congenital diseases were excluded. Control for confounders was performed. The level of significance was set at p<0.05. After exclusions, there were 17,988 births (1653 late preterm and 16,345 term infants). A higher mortality in LPT versus term was observed, with an adjusted odds ratio (OR) of 5.29 (p<0.0001). Most complications were significantly associated with LPT births. There was a significant increase in LPT rate throughout the study period, but no significant trend in the rate of medically indicated deliveries. A higher mortality was observed in early term versus late term infants, with adjusted OR: 2.43 (p=0.038). LPT and early term infants have a significantly higher risk of death.
Resumo:
To analyze the effects of treatment approach on the outcomes of newborns (birth weight [BW] < 1,000 g) with patent ductus arteriosus (PDA), from the Brazilian Neonatal Research Network (BNRN) on: death, bronchopulmonary dysplasia (BPD), severe intraventricular hemorrhage (IVH III/IV), retinopathy of prematurity requiring surgical (ROPsur), necrotizing enterocolitis requiring surgery (NECsur), and death/BPD. This was a multicentric, cohort study, retrospective data collection, including newborns (BW < 1000 g) with gestational age (GA) < 33 weeks and echocardiographic diagnosis of PDA, from 16 neonatal units of the BNRN from January 1, 2010 to Dec 31, 2011. Newborns who died or were transferred until the third day of life, and those with presence of congenital malformation or infection were excluded. Groups: G1 - conservative approach (without treatment), G2 - pharmacologic (indomethacin or ibuprofen), G3 - surgical ligation (independent of previous treatment). Factors analyzed: antenatal corticosteroid, cesarean section, BW, GA, 5 min. Apgar score < 4, male gender, Score for Neonatal Acute Physiology Perinatal Extension (SNAPPE II), respiratory distress syndrome (RDS), late sepsis (LS), mechanical ventilation (MV), surfactant (< 2 h of life), and time of MV. death, O2 dependence at 36 weeks (BPD36wks), IVH III/IV, ROPsur, NECsur, and death/BPD36wks. Student's t-test, chi-squared test, or Fisher's exact test; Odds ratio (95% CI); logistic binary regression and backward stepwise multiple regression. Software: MedCalc (Medical Calculator) software, version 12.1.4.0. p-values < 0.05 were considered statistically significant. 1,097 newborns were selected and 494 newborns were included: G1 - 187 (37.8%), G2 - 205 (41.5%), and G3 - 102 (20.6%). The highest mortality was observed in G1 (51.3%) and the lowest in G3 (14.7%). The highest frequencies of BPD36wks (70.6%) and ROPsur were observed in G3 (23.5%). The lowest occurrence of death/BPD36wks occurred in G2 (58.0%). Pharmacological (OR 0.29; 95% CI: 0.14-0.62) and conservative (OR 0.34; 95% CI: 0.14-0.79) treatments were protective for the outcome death/BPD36wks. The conservative approach of PDA was associated to high mortality, the surgical approach to the occurrence of BPD36wks and ROPsur, and the pharmacological treatment was protective for the outcome death/BPD36wks.
Resumo:
Cardiac arrhythmias are one of the main causes of death worldwide. Several studies have shown that inflammation plays a key role in different cardiac diseases and Toll-like receptors (TLRs) seem to be involved in cardiac complications. In the present study, we investigated whether the activation of TLR4 induces cardiac electrical remodeling and arrhythmias, and the signaling pathway involved in these effects. Membrane potential was recorded in Wistar rat ventricle. Ca(2+) transients, as well as the L-type Ca(2+) current (ICaL) and the transient outward K(+) current (Ito), were recorded in isolated myocytes after 24 h exposure to the TLR4 agonist, lipopolysaccharide (LPS, 1 μg/ml). TLR4 stimulation in vitro promoted a cardiac electrical remodeling that leads to action potential prolongation associated with arrhythmic events, such as delayed afterdepolarization and triggered activity. After 24 h LPS incubation, Ito amplitude, as well as Kv4.3 and KChIP2 mRNA levels were reduced. The Ito decrease by LPS was prevented by inhibition of interferon regulatory factor 3 (IRF3), but not by inhibition of interleukin-1 receptor-associated kinase 4 (IRAK4) or nuclear factor kappa B (NF-κB). Extrasystolic activity was present in 25% of the cells, but apart from that, Ca(2+) transients and ICaL were not affected by LPS; however, Na(+)/Ca(2+) exchanger (NCX) activity was apparently increased. We conclude that TLR4 activation decreased Ito, which increased AP duration via a MyD88-independent, IRF3-dependent pathway. The longer action potential, associated with enhanced Ca(2+) efflux via NCX, could explain the presence of arrhythmias in the LPS group.
Resumo:
The purpose of this study was to assess whether the adhesive permits the collateral repair of axons originating from a vagus nerve to the interior of a sural nerve graft, and whether low-level laser therapy (LLLT) assists in the regeneration process. Study sample consisted of 32 rats randomly separated into three groups: Control Group (CG; n=8), from which the intact sural nerve was collected; Experimental Group (EG; n=12), in which one of the ends of the sural nerve graft was coapted to the vagus nerve using the fibrin glue; and Experimental Group Laser (EGL; n=12), in which the animals underwent the same procedures as those in EG with the addition of LLLT. Ten weeks after surgery, the animals were euthanized. Morphological analysis by means of optical and electron microscopy, and morphometry of the regenerated fibers were employed to evaluate the results. Collateral regeneration of axons was observed from the vagus nerve to the interior of the autologous graft in EG and EGL, and in CG all dimensions measured were greater and presented a significant difference in relation to EG and EGL, except for the area and thickness of the myelin sheath, that showed significant difference only in relation to the EG. The present study demonstrated that the fibrin glue makes axonal regeneration feasible and is an efficient method to recover injured peripheral nerves, and the use of low-level laser therapy enhances nerve regeneration.
Resumo:
Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Objective To evaluate the occurrence of severe obstetric complications associated with antepartum and intrapartum hemorrhage among women from the Brazilian Network for Surveillance of Severe Maternal Morbidity.Design Multicenter cross-sectional study.Setting Twenty-seven obstetric referral units in Brazil between July 2009 and June 2010.Population A total of 9555 women categorized as having obstetric complications.Methods The occurrence of potentially life-threatening conditions, maternal near miss and maternal deaths associated with antepartum and intrapartum hemorrhage was evaluated. Sociodemographic and obstetric characteristics and the use of criteria for management of severe bleeding were also assessed in these women.Main outcome measures The prevalence ratios with their respective 95% confidence intervals adjusted for the cluster effect of the design, and multiple logistic regression analysis were performed to identify factors independently associated with the occurrence of severe maternal outcome.Results Antepartum and intrapartum hemorrhage occurred in only 8% (767) of women experiencing any type of obstetric complication. However, it was responsible for 18.2% (140) of maternal near miss and 10% (14) of maternal death cases. On multivariate analysis, maternal age and previous cesarean section were shown to be independently associated with an increased risk of severe maternal outcome (near miss or death).Conclusion Severe maternal outcome due to antepartum and intrapartum hemorrhage was highly prevalent among Brazilian women. Certain risk factors, maternal age and previous cesarean delivery in particular, were associated with the occurrence of bleeding.