7 resultados para Insetos - Identificação

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Raman imaging spectroscopy is a highly useful analytical tool that provides spatial and spectral information on a sample. However, CCD detectors used in dispersive instruments present the drawback of being sensitive to cosmic rays, giving rise to spikes in Raman spectra. Spikes influence variance structures and must be removed prior to the use of multivariate techniques. A new algorithm for correction of spikes in Raman imaging was developed using an approach based on comparison of nearest neighbor pixels. The algorithm showed characteristics including simplicity, rapidity, selectivity and high quality in spike removal from hyperspectral images.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficiency of swine production performance depends on the herd administration, such as good nutrition, sanitary control, facilities and appropriate environmental conditions. The concept of this production model is directly related with the reduction of selective losses and the process control. Each production segment is controlled to reach the optimization in the system totality, it is necessary to apply animals handling concepts, environmental control implementation, diseases control, nutrition control, information concerning in guaranteeing the animal welfare and individual identification. The present work presents as objective the development of the mathematical model to evaluate interactions among the internal atmosphere of the installation and the thermal animals preference, in the expectation of detecting a relationship among the frequency access to the drinking fountain and the atmosphere conditions - temperature, black globe temperature and relative humidity, using as tool the electronic identification. The results obtained by the mathematical model, allowed to conclude accurately the evaluation of the swine thermal preference correlating with the climatic variables in the pregnancy stage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Animal welfare has been an important research topic in animal production mainly in its ways of assessment. Vocalization is found to be an interesting tool for evaluating welfare as it provides data in a non-invasive way as well as it allows easy automation of process. The present research had as objective the implementation of an algorithm based on artificial neural network that had the potential of identifying vocalization related to welfare pattern indicatives. The research was done in two parts, the first was the development of the algorithm, and the second its validation with data from the field. Previous records allowed the development of the algorithm from behaviors observed in sows housed in farrowing cages. Matlab® software was used for implementing the network. It was selected a retropropagation gradient algorithm for training the network with the following stop criteria: maximum of 5,000 interactions or error quadratic addition smaller than 0.1. Validation was done with sows and piglets housed in commercial farm. Among the usual behaviors the ones that deserved enhancement were: the feed dispute at farrowing and the eventual risk of involuntary aggression between the piglets or between those and the sow. The algorithm was able to identify through the noise intensity the inherent risk situation of piglets welfare reduction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física