Hepatic Involvement In Paediatric Patients With Paracoccidioidomycosis: A Histological Study.

Paracoccidioidomycosis is a systemic mycosis that is endemic to certain countries in Latin America. This study aimed to describe the histological features of liver involvement in patients with paracoccidioidomycosis aged <16 years of age who were treated between 1980 and 2010, with a diagnosis that was confirmed by detection of the fungus by pathological examination. Liver tissue was obtained from one necropsy and 12 biopsies. Throughout 2007, biopsies were taken from patients with persistent jaundice or portal hypertension, after which biopsies became indicated due to elevated aminotransferase and low albumin levels. Using haematoxylin and eosin (H&E), Masson's trichrome and immunohistochemical (CK7 and CK19) staining, we noted degenerative alterations in bile duct cells and inflammatory injury to the bile ducts in 10 biopsies. Using immunohistochemistry for CK7 and CK19, we observed ductal proliferation in all 12 samples. Bile duct injuries by inflammatory cells might explain the predominant increase in canalicular enzymes; immunohistochemistry is more sensitive in demonstrating ductular reactions and might show changes that are not apparent on H&E staining.

The Characterization Of The Endoglucanase Cel12a From Gloeophyllum Trabeum Reveals An Enzyme Highly Active On β-glucan.

The basidiomycete fungus Gloeophyllum trabeum causes a typical brown rot and is known to use reactive oxygen species in the degradation of cellulose. The extracellular Cel12A is one of the few endo-1,4-β-glucanase produced by G. trabeum. Here we cloned cel12A and heterologously expressed it in Aspergillus niger. The identity of the resulting recombinant protein was confirmed by mass spectrometry. We used the purified GtCel12A to determine its substrate specificity and basic biochemical properties. The G. trabeum Cel12A showed highest activity on β-glucan, followed by lichenan, carboxymethylcellulose, phosphoric acid swollen cellulose, microcrystalline cellulose, and filter paper. The optimal pH and temperature for enzymatic activity were, respectively, 4.5 and 50 °C on β-glucan. Under these conditions specific activity was 239.2 ± 9.1 U mg(-1) and the half-life of the enzyme was 84.6 ± 3.5 hours. Thermofluor studies revealed that the enzyme was most thermal stable at pH 3. Using β-glucan as a substrate, the Km was 3.2 ± 0.5 mg mL(-1) and the Vmax was 0.41 ± 0.02 µmol min(-1). Analysis of the effects of GtCel12A on oat spelt and filter paper by scanning electron microscopy revealed the morphological changes taking place during the process.

Partitioning The Net Effect Of Host Diversity On An Emerging Amphibian Pathogen.

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

High-resolution Transcript Profiling Of The Atypical Biotrophic Interaction Between Theobroma Cacao And The Fungal Pathogen Moniliophthora Perniciosa.

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

Analysis Of The Ergosterol Biosynthesis Pathway Cloning, Molecular Characterization And Phylogeny Of Lanosterol 14 α-demethylase (erg11) Gene Of Moniliophthora Perniciosa.

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

Apoplastic And Intracellular Plant Sugars Regulate Developmental Transitions In Witches' Broom Disease Of Cacao.

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Low-level Laser Therapy To The Mouse Femur Enhances The Fungicidal Response Of Neutrophils Against Paracoccidioides Brasiliensis.

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

In Vivo Determination Of The Volatile Metabolites Of Saprotroph Fungi By Comprehensive Two-dimensional Gas Chromatography.

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

Sistema limpo em linha para extração em fase sólida de contaminantes emergentes em águas naturais

A solid-phase in-line extraction system for water samples containing low levels of emerging contaminants is described. The system was specially developed for large volume samples (up to 4 L) using commercial solid-phase extraction (SPE) cartridges. Four sets containing PTFE-made connectors, brass adapters and ball valves were used to fit SPE cartridges and sample bottles to a 4-port manifold attached to a 20 L carboy. A lab-made vacuum device was connected to the manifold cap. The apparatus is robust and less expensive than the typical available system. Its also provides less experimental handling, avoiding cross contamination and sample losses.

Estudo dos efeitos de temporada de treinamento físico sobre a Performance de uma equipe de handebol feminino sub-21

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

Variáveis objetivas e subjetivas para monitoramento de diferentes ciclos de temporada em jogadores de basquete

The present study aimed to evaluate, compare and relate load and training tiredness during a periodization cycle in basketball players. Eight professional male athletes aged 21.9 ± 3.4 years, all of whom participated in the São Paulo basketball championship, special division, took part in this study. The macrocycle analyzed encompassed 19 weeks divided into the following periods: Preparatory, Competitive I, and Competitive II (having 4, 6, and 9 weeks, respectively). The authors daily evaluated the athletes on subjective perception of tiredness and training load and monitored the athletes' upper limb power by quantifying their ability to throw a medicine ball. Athletes presented less fatigue (p <0.005) in the Preparatory period (13.71 ± 1.30) compared with the Competitive I (14.68 ± 1.51) and Competitive II (14.63 ± 1.22) periods. Their ability to throw the medicine ball decreased (p <0.005) in the Competitive period II (3.59 ± 0.30) compared with the Preparatory (3.80 ± 0.36) and Competitive I (3.86 ± 0.26) periods. Their monotony decreased (p <0.001) in the Competitive period II (1.18 ± 0.43) compared with the Preparatory (2.50 ± 2.01) and Competitive I (2.10 ± 1.61) periods. The results revealed the effectiveness of monitoring load and tiredness of athletes by means of the proposed method to assist in training organization during a macrocycle.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Validação de uma bateria de testes de habilidades motoras para atletas de handebol em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Praticas socioculturais, poder e diferenciação em Bico, Cuiamucu e Canela-Fina - comunidades amazonicas

Universidade Estadual de Campinas . Faculdade de Educação Física