Uma analise das alterações nas variáveis fisiológicas e aptidão física (teste da FIFA) e suas prováveis interferências no desempenho do arbitro durante a partida

Universidade Estadual de Campinas. Faculdade de Educação Física

Futebol : estudo da alteração de variaveis anaerobicas e da composição corporal em atletas profissionais durante um macrociclo de treinamento

Universidade Estadual de Campinas. Faculdade de Educação Física

A ginastica geral na sociedade contemporanea : pespectivas para a Educação Fisica escolar

Universidade Estadual de Campinas. Faculdade de Educação Física

Desvelando os significados da vivencia da ginastica geral para adolescentes de uma instituição salesiana de proteção a criança e ao adolescente

Universidade Estadual de Campinas. Faculdade de Educação Física

Fatores de stress em jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física

Variation of the anal resting pressure induced by postexpiratory apnea effort in patients with constipation

CONTEXT: Intestinal constipation - a common symptom among the general population - is more frequent in women. It may be secondary to an improper diet or organic or functional disturbances, such as dyskinesia of the pelvic floor. This is basically characterized by the absence of relaxation or paradoxical contraction of the pelvic floor and anal sphincter during evacuation. OBJECTIVE: To analyze, by manometric data, the anal pressure variation at rest, during evacuation effort by using the Valsalva maneuver and forced post-expiratory apnea in subjects with secondary constipation. METHODS: Twenty-one patients (19 females - 90.4%) with a mean age of 47.5 years old (23-72) were studied. The diagnosis was performed using anorectal manometry, with a catheter containing eight channels disposed at the axial axis, measuring the proximal (1) and distal (2) portions of the anal orifice. The elevation of the pressure values in relation to the resting with the evacuation effort was present in all patients. The Agachan score was used for clinical evaluation of constipation. The variables studied were: mean anal pressure of the anal orifice for 20 seconds at rest, the effort of evacuation using Valsalva maneuver and the effort of evacuation during apnea after forced expiration, as well as the area under the curve of the manometric tracing at moments Valsalva and apnea. RESULTS: The analysis of the mean values of the anal pressure variation at rest evidenced difference between proximal and distal channels (P = 0.007), independent of the moment and tendency to differ during moments Valsalva and apnea (P = 0.06). The mean of values of the area under the manometric tracing curve showed differences between moments Valsalva and apnea (P = 0.0008), either at the proximal portion or at the distal portion of the anal orifice. CONCLUSION: The effort of evacuation associated with postexpiratory apnea, when compared with the effort associated with the Valsalva maneuver, provides lower elevation of anal pressure at rest by the parameter area under the curve.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Representação da área de responsabilidade de jogadores de futebol através do Diagrama de Voronoi

Universidade Estadual de Campinas . Faculdade de Educação Física

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise dos esforços de alta intensidade de jogadores de futebol profissional

Universidade Estadual de Campinas . Faculdade de Educação Física

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física

A abordagem centrada na pessoa e a psicologia do esporte : vivência de um psicólogo com jogadores e a comissão técnica de uma equipe durante os períodos de preparação e disputa da Copa São Paulo de Futebol Júnior

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise da descontinuidade do patrocinio esportivo em clubes de futebol no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição e avaliação de um modelo de representação dos membros superiores e escapula durante a marcha humana

Universidade Estadual de Campinas . Faculdade de Educação Física

O jogo de futebol : investigação de sua estrutura, de seus modelos e da inteligencia de jogo, do ponto de vista da complexidade

Universidade Estadual de Campinas . Faculdade de Educação Física