Analise da descontinuidade do patrocinio esportivo em clubes de futebol no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

A pratica de exercicios resistidos por pessoas com esclerose multipla

Universidade Estadual de Campinas . Faculdade de Educação Física

The Effect Of Poly(methyl Methacrylate) Surface Treatments On The Adhesion Of Silicone-based Resilient Denture Liners.

Different surface treatment protocols of poly(methyl methacrylate) have been proposed to improve the adhesion of silicone-based resilient denture liners to poly(methyl methacrylate) surfaces. The purpose of this study was to evaluate the effect of different poly(methyl methacrylate) surface treatments on the adhesion of silicone-based resilient denture liners. Poly(methyl methacrylate) specimens were prepared and divided into 4 treatment groups: no treatment (control), methyl methacrylate for 180 seconds, acetone for 30 seconds, and ethyl acetate for 60 seconds. Poly(methyl methacrylate) disks (30.0 × 5.0 mm; n = 10) were evaluated regarding surface roughness and surface free energy. To evaluate tensile bond strength, the resilient material was applied between 2 treated poly(methyl methacrylate) bars (60.0 × 5.0 × 5.0 mm; n = 20 for each group) to form a 2-mm-thick layer. Data were analyzed by 1-way ANOVA and the Tukey honestly significant difference tests (α = .05). A Pearson correlation test verified the influence of surface properties on tensile bond strength. Failure type was assessed, and the poly(methyl methacrylate) surface treatment modifications were visualized with scanning electron microscopy. The surface roughness was increased (P < .05) by methyl methacrylate treatment. For the acetone and ethyl acetate groups, the surface free energy decreased (P < .05). The tensile bond strength was higher for the methyl methacrylate and ethyl acetate groups (P < .05). No correlation was found regarding surface properties and tensile bond strength. Specimens treated with acetone and methyl methacrylate presented a cleaner surface, whereas the ethyl acetate treatment produced a porous topography. The methyl methacrylate and ethyl acetate surface treatment protocols improved the adhesion of a silicone-based resilient denture liner to poly(methyl methacrylate).

Disarray Of Glomerular And Tubular Cell Adhesion Molecules In The Course Of Experimental Bothrops Moojeni Envenomation.

In this study, we show that administration of Bothrops moojeni venom in rats induces a general disturbance in the distribution and content of the tight junctional protein ZO-1, the cell-matrix receptor beta 1 integrin, the cytoskeletal proteins, vinculin and F-actin, and of the extracellular matrix component laminin in renal corpuscles and cortical nephron tubules. These findings suggest that cell-cell and cell-matrix adhesion proteins may be molecular targets in the B. moojeni-induced kidney injury.

Analysis Of Cellular Adhesion On Superhydrophobic And Superhydrophilic Vertically Aligned Carbon Nanotube Scaffolds.

We analyzed GFP cells after 24h cultivated on superhydrophilic vertically aligned carbon nanotube scaffolds. We produced two different densities of VACNT scaffolds on Ti using Ni or Fe catalysts. A simple and fast oxygen plasma treatment promoted the superhydrophilicity of them. We used five different substrates, such as: as-grown VACNT produced using Ni as catalyst (Ni), as-grown VACNT produced using Fe as catalyst (Fe), VACNT-O produced using Ni as catalyst (NiO), VACNT-O produced using Fe as catalyst (FeO) and Ti (control). The 4',6-diamidino-2-phenylindole reagent nuclei stained the adherent cells cultivated on five different analyzed scaffolds. We used fluorescence microscopy for image collect, ImageJ® to count adhered cell and GraphPad Prism 5® for statistical analysis. We demonstrated in crescent order: Fe, Ni, NiO, FeO and Ti scaffolds that had an improved cellular adhesion. Oxygen treatment associated to high VACNT density (group FeO) presented significantly superior cell adhesion up to 24h. However, they do not show significant differences compared with Ti substrates (control). We demonstrated that all the analyzed substrates were nontoxic. Also, we proposed that the density and hydrophilicity influenced the cell adhesion behavior.

Integrated Proteomics Identified Up-regulated Focal Adhesion-mediated Proteins In Human Squamous Cell Carcinoma In An Orthotopic Murine Model.

Understanding the molecular mechanisms of oral carcinogenesis will yield important advances in diagnostics, prognostics, effective treatment, and outcome of oral cancer. Hence, in this study we have investigated the proteomic and peptidomic profiles by combining an orthotopic murine model of oral squamous cell carcinoma (OSCC), mass spectrometry-based proteomics and biological network analysis. Our results indicated the up-regulation of proteins involved in actin cytoskeleton organization and cell-cell junction assembly events and their expression was validated in human OSCC tissues. In addition, the functional relevance of talin-1 in OSCC adhesion, migration and invasion was demonstrated. Taken together, this study identified specific processes deregulated in oral cancer and provided novel refined OSCC-targeting molecules.

Mesenchymal Stromal Cells From Adipose Tissue Attached To Suture Material Enhance The Closure Of Enterocutaneous Fistulas In A Rat Model.

Surgical treatment for enterocutaneous fistulas (EF) frequently fails. Cell therapy may represent a new approach to treatment. Mesenchymal stromal cells (MSCs) have high proliferative and differentiation capacity. This study aimed to investigate whether MSCs could adhere to suture filament (SF), promoting better EF healing. MSCs, 1 × 10(6), from adipose tissue (ATMSCs) were adhered to a Polyvicryl SF by adding a specific fibrin glue formulation. Adhesion was confirmed by confocal and scanning electron microscopy (SEM). A cecal fistula was created in 22 Wistar rats by incising the cecum and suturing the opening to the surgical wound subcutaneously with four separate stitches. The animals were randomly allocated to three groups: control (CG)-five animals, EF performed; injection (IG)-eight animals 1 × 10(6) ATMSCs injected around EF borders; and suture filament (SG): nine animals, sutured with 1 × 10(6) ATMSCs attached to the filaments with fibrin glue. Fistulas were photographed on the operation day and every 3 days until the 21st day and analyzed by two observers using ImageJ Software. Confocal and SEM results demonstrated ATMSCs adhered to SF (ATMSCs-SF). The average reduction size of the fistula area at 21st day was greater for the SG group (90.34%, P < 0.05) than the IG (71.80%) and CG (46.54%) groups. ATMSCs adhered to SF maintain viability and proliferative capacity. EF submitted to ATMSCs-SF procedure showed greater recovery and healing. This approach might be a new and effective tool for EF treatment.

Staphylococcus Aureus Enterotoxins A And B Inhibit Human And Mice Eosinophil Chemotaxis And Adhesion In Vitro.

Staphylococcus aureus aggravates the allergic eosinophilic inflammation. We hypothesized that Staphylococcus aureus-derived enterotoxins directly affect eosinophil functions. Therefore, this study investigated the effects of Staphylococcal enterotoxins A and B (SEA and SEB) on human and mice eosinophil chemotaxis and adhesion in vitro, focusing on p38 MAPK phosphorylation and intracellular Ca(2+) mobilization. Eosinophil chemotaxis was evaluated using a microchemotaxis chamber, whereas adhesion was performed in VCAM-1 and ICAM-1-coated plates. Measurement of p38 MAPK phosphorylation and intracellular Ca(2+) levels were monitored by flow cytometry and fluorogenic calcium-binding dye, respectively. Prior incubation (30 to 240 min) of human blood eosinophils with SEA (0.5 to 3 ng/ml) significantly reduced eotaxin-, PAF- and RANTES-induced chemotaxis (P<0.05). Likewise, SEB (1 ng/ml, 30 min) significantly reduced eotaxin-induced human eosinophil chemotaxis (P<0.05). The reduction of eotaxin-induced human eosinophil chemotaxis by SEA and SEB was prevented by anti-MHC monoclonal antibody (1 μg/ml). In addition, SEA and SEB nearly suppressed the eotaxin-induced human eosinophil adhesion in ICAM-1- and VCAM-1-coated plates. SEA and SEB prevented the increases of p38 MAPK phosphorylation and Ca(2+) levels in eotaxin-activated human eosinophils. In separate protocols, we evaluated the effects of SEA on chemotaxis and adhesion of eosinophils obtained from mice bone marrow. SEA (10 ng/ml) significantly reduced the eotaxin-induced chemotaxis along with cell adhesion to both ICAM-1 and VCAM-1-coated plates (P<0.05). In conclusion, the inhibition by SEA and SEB of eosinophil functions (chemotaxis and adhesion) are associated with reductions of p38 MAPK phosphorylation and intracellular Ca(2+) mobilization.

Reduced Lrp6 Expression And Increase In The Interaction Of Gsk3β With P53 Contribute To Podocyte Apoptosis In Diabetes Mellitus And Are Prevented By Green Tea.

In diabetes mellitus (DM), podocyte apoptosis leads to albuminuria and nephropathy progression. Low-density lipoprotein receptor-related protein 6 (LRP6) is WNT pathway receptor that is involved in podocyte death, adhesion and motility. Glycogen synthase kinase 3 (GSK3) interaction with p53 (GSK3-p53) promotes apoptosis in carcinoma cells. It is unknown if GSK3-p53 contributes to podocyte apoptosis in DM. In experimental DM, green tea (GT) reduces albuminuria by an unknown mechanism. In the present study, we assessed the role of the GSK3β-p53 in podocyte apoptosis and the effects of GT on these abnormalities. In diabetic spontaneously hypertensive rats (SHRs), GT prevents podocyte's p-LRP6 expression reduction, increased GSK3β-p53 and high p53 levels. In diabetic SHR rats, GT reduces podocyte apoptosis, foot process effacement and albuminuria. In immortalized mouse podocytes (iMPs), high glucose (HG), silencing RNA (siRNA) or blocking LRP6 (DKK-1) reduced p-LRP6 expression, leading to high GSK3β-p53, p53 expression, apoptosis and increased albumin influx. GSK3β blockade by BIO reduced GSK3β-p53 and podocyte apoptosis. In iMPs under HG, GT reduced apoptosis and the albumin influx by blocking GSK3β-p53 following the rise in p-LRP6 expression. These effects of GT were prevented by LRP6 siRNA or DKK-1. In conclusion, in DM, WNT inhibition, via LRP6, increases GSK3β-p53 and podocyte apoptosis. Maneuvers that inactivate GSK3β-p53, such as GT, may be renoprotective in DM.

In vitro Microfluidic Model For The Study Of Vaso-occlusive Processes.

Vaso-occlusion, responsible for much of the morbidity of sickle-cell disease, is a complex multicellular process, apparently triggered by leukocyte adhesion to the vessel wall. The microcirculation represents a major site of leukocyte-endothelial interactions and vaso-occlusive processes. We have developed a biochip with subdividing interconnecting microchannels that decrease in size (40 μm to 10 μm in width), for use in conjunction with a precise microfluidic device, to mimic cell flow and adhesion through channels of sizes that approach those of the microcirculation. The biochips were utilized to observe the dynamics of the passage of neutrophils and red blood cells, isolated from healthy and sickle-cell anemia (SCA) individuals, through laminin or endothelial adhesion molecule-coated microchannels at physiologically relevant rates of flow and shear stress. Obstruction of E-selectin/intercellular adhesion molecule 1-coated biochip microchannels by SCA neutrophils was significantly greater than that observed for healthy neutrophils, particularly in the microchannels of 40-15 μm in width. Whereas SCA red blood cells alone did not significantly adhere to, or obstruct, microchannels, mixed suspensions of SCA neutrophils and red blood cells significantly adhered to and obstructed laminin-coated channels. Results from this in vitro microfluidic model support a primary role for leukocytes in the initiation of SCA occlusive processes in the microcirculation. This assay represents an easy-to-use and reproducible in vitro technique for understanding molecular mechanisms and cellular interactions occurring in subdividing microchannels of widths approaching those observed in the microvasculature. The assay could hold potential for testing drugs developed to inhibit occlusive mechanisms such as those observed in SCA and thrombotic diseases.

Influence Of The Major Nitrite Transporter Nirc On The Virulence Of A Swollen Head Syndrome Avian Pathogenic E. Coli (apec) Strain.

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.