7 resultados para Celulas - Adesão adesão
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.
Resumo:
Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Purpose: Amblyopia is the most common form of visual problem in children and for more than 250 years occlusion therapy is the standard treatment. Thus our purpose is to identify the factors that influence the outcome of amblyopia treatment with occlusion therapy. Methods: We reviewed 169 amblyopic children seen in the outpatient clinic of amblyopia of the Campinas State University, between January 1996 and May 1998. Patients were analyzed regar-ding sex, age at start of treatment (3 groups), affected eye, type of amblyopia (strabismic, anisometropic, visual depri-vation, associated), follow-up, initial visual acuity (light, moderate, severe), compliance with treatment (good, poor) and outcome (fully treated, partially treated, not treated). Results: Compliance was not seen to be significantly related to age at start of treatment (p=0.68) or initial visual acuity (p=0.82). 52.67% of the patients were fully treated while 19.52% were partially treated and 27.81% were not treated. Children recorded as showing good compliance had a significantly better outcome than those with poor complian-ce (p=0.0009). Neither the age at start of treatment (p=0.39) nor the initial visual acuity (p=0.30) were significantly corre-lated with the final outcome. Conclusions: We concluded that the main factor affecting the final outcome of amblyopia treatment is compliance.
Resumo:
Purpose: An experimental study to evaluate the behavior of polytetrafluoroethylene (Gore-Tex®) compared with human sclera, in scleral perforations induced in rabbits eyes was performed. Methods: Twenty-two eyes of rabbits were submitted to scleral perforation followed by Gore-Tex® graft in the left eye and human sclera graft in the right eye respectively. During one month the postoperative evolution was analyzed every day: intensity of hyperemia, presence of infection, secretion, rejection and tonicity of the eyes. Results: No cases of secretion, infection or rejection were observed. The histological sections showed fibrosis in the eyes with Gore-Tex®, good adhesion and epithelization. Conclusion: The Gore-Tex® showed to be a plausible material to be used as graft in scleral defects with some advantages such as easy obtention, good handling and durability.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física