110 resultados para Ascospores and germination

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Characterized for the first time in erythrocytes, phosphatidylinositol phosphate kinases (PIP kinases) belong to a family of enzymes that generate various lipid messengers and participate in several cellular processes, including gene expression regulation. Recently, the PIPKIIα gene was found to be differentially expressed in reticulocytes from two siblings with hemoglobin H disease, suggesting a possible relationship between PIPKIIα and the production of globins. Here, we investigated PIPKIIα gene and protein expression and protein localization in hematopoietic-derived cells during their differentiation, and the effects of PIPKIIα silencing on K562 cells. PIPKIIα silencing resulted in an increase in α and γ globins and a decrease in the proliferation of K562 cells without affecting cell cycle progression and apoptosis. In conclusion, using a cell line model, we showed that PIPKIIα is widely expressed in hematopoietic-derived cells, is localized in their cytoplasm and nucleus, and is upregulated during erythroid differentiation. We also showed that PIPKIIα silencing can induce α and γ globin expression and decrease cell proliferation in K562 cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Bone marrow is organized in specialized microenvironments known as 'marrow niches'. These are important for the maintenance of stem cells and their hematopoietic progenitors whose homeostasis also depends on other cell types present in the tissue. Extrinsic factors, such as infection and inflammatory states, may affect this system by causing cytokine dysregulation (imbalance in cytokine production) and changes in cell proliferation and self-renewal rates, and may also induce changes in the metabolism and cell cycle. Known to relate to chronic inflammation, obesity is responsible for systemic changes that are best studied in the cardiovascular system. Little is known regarding the changes in the hematopoietic system induced by the inflammatory state carried by obesity or the cell and molecular mechanisms involved. The understanding of the biological behavior of hematopoietic stem cells under obesity-induced chronic inflammation could help elucidate the pathophysiological mechanisms involved in other inflammatory processes, such as neoplastic diseases and bone marrow failure syndromes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the structural and molecular effects of antiangiogenic therapies and finasteride on the ventral prostate of senile mice. 90 male FVB mice were divided into: Young (18 weeks old) and senile (52 weeks old) groups; finasteride group: finasteride (20mg/kg); SU5416 group: SU5416 (6 mg/kg); TNP-470 group: TNP-470 (15 mg/kg,) and SU5416+TNP-470 group: similar to the SU5416 and TNP-470 groups. After 21 days, prostate ventral lobes were collected for morphological, immunohistochemical and Western blotting analyses. The results demonstrated atrophy, occasional proliferative lesions and inflammatory cells in the prostate during senescence, which were interrupted and/or blocked by treatment with antiangiogenic drugs and finasteride. Decreased AR and endostatin reactivities, and an increase for ER-α, ER-β and VEGF, were seen in the senile group. Decreased VEGF and ER-α reactivities and increased ER-β reactivity were verified in the finasteride, SU5416 groups and especially in SU5416+TNP-470 group. The TNP-470 group showed reduced AR and ER-β protein levels. The senescence favored the occurrence of structural and/or molecular alterations suggesting the onset of malignant lesions, due to the imbalance in the signaling between the epithelium and stroma. The SU5416+TNP-470 treatment was more effective in maintaining the structural, hormonal and angiogenic factor balance in the prostate during senescence, highlighting the signaling of antiproliferation via ER-β.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the study was to analyze the frequency of epidermal growth factor receptor (EGFR) mutations in Brazilian non-small cell lung cancer patients and to correlate these mutations with response to benefit of platinum-based chemotherapy in non-small cell lung cancer (NSCLC). Our cohort consisted of prospective patients with NSCLCs who received chemotherapy (platinum derivates plus paclitaxel) at the [UNICAMP], Brazil. EGFR exons 18-21 were analyzed in tumor-derived DNA. Fifty patients were included in the study (25 with adenocarcinoma). EGFR mutations were identified in 6/50 (12 %) NSCLCs and in 6/25 (24 %) adenocarcinomas; representing the frequency of EGFR mutations in a mostly self-reported White (82.0 %) southeastern Brazilian population of NSCLCs. Patients with NSCLCs harboring EGFR exon 19 deletions or the exon 21 L858R mutation were found to have a higher chance of response to platinum-paclitaxel (OR 9.67 [95 % CI 1.03-90.41], p = 0.047). We report the frequency of EGFR activating mutations in a typical southeastern Brazilian population with NSCLC, which are similar to that of other countries with Western European ethnicity. EGFR mutations seem to be predictive of a response to platinum-paclitaxel, and additional studies are needed to confirm or refute this relationship.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Intermittent fasting (IF) is an often-used intervention to decrease body mass. In male Sprague-Dawley rats, 24 hour cycles of IF result in light caloric restriction, reduced body mass gain, and significant decreases in the efficiency of energy conversion. Here, we study the metabolic effects of IF in order to uncover mechanisms involved in this lower energy conversion efficiency. After 3 weeks, IF animals displayed overeating during fed periods and lower body mass, accompanied by alterations in energy-related tissue mass. The lower efficiency of energy use was not due to uncoupling of muscle mitochondria. Enhanced lipid oxidation was observed during fasting days, whereas fed days were accompanied by higher metabolic rates. Furthermore, an increased expression of orexigenic neurotransmitters AGRP and NPY in the hypothalamus of IF animals was found, even on feeding days, which could explain the overeating pattern. Together, these effects provide a mechanistic explanation for the lower efficiency of energy conversion observed. Overall, we find that IF promotes changes in hypothalamic function that explain differences in body mass and caloric intake.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous results provided evidence that Cratylia mollis seed lectin (Cramoll 1,4) promotes Trypanosoma cruzi epimastigotes death by necrosis via a mechanism involving plasma membrane permeabilization to Ca(2+) and mitochondrial dysfunction due to matrix Ca(2+) overload. In order to investigate the mechanism of Ca(2+) -induced mitochondrial impairment, experiments were performed analyzing the effects of this lectin on T. cruzi mitochondrial fraction and in isolated rat liver mitochondria (RLM), as a control. Confocal microscopy of T. cruzi whole cell revealed that Cramoll 1,4 binding to the plasma membrane glycoconjugates is followed by its internalization and binding to the mitochondrion. Electrical membrane potential (∆Ψm ) of T. cruzi mitochondrial fraction suspended in a reaction medium containing 10 μM Ca(2+) was significantly decreased by 50 μg/ml Cramoll 1,4 via a mechanism insensitive to cyclosporine A (CsA, membrane permeability transition (MPT) inhibitor), but sensitive to catalase or 125 mM glucose. In RLM suspended in a medium containing 10 μM Ca(2+) this lectin, at 50 μg/ml, induced increase in the rate of hydrogen peroxide release, mitochondrial swelling, and ∆Ψm disruption. All these mitochondrial alterations were sensitive to CsA, catalase, and EGTA. These results indicate that Cramoll 1, 4 leads to inner mitochondrial membrane permeabilization through Ca(2+) dependent mechanisms in both mitochondria. The sensitivity to CsA in RLM characterizes this lectin as a MPT inducer and the lack of CsA effect identifies a CsA-insensitive MPT in T. cruzi mitochondria.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phospholipases A2 (PLA2) are key enzymes for production of lipid mediators. We previously demonstrated that a snake venom sPLA2 named MT-III leads to prostaglandin (PG)E2 biosynthesis in macrophages by inducing the expression of cyclooxygenase-2 (COX-2). Herein, we explored the molecular mechanisms and signaling pathways leading to these MT-III-induced effects. Results demonstrated that MT-III induced activation of the transcription factor NF-κB in isolated macrophages. By using NF-κB selective inhibitors, the involvement of this factor in MT-III-induced COX-2 expression and PGE2 production was demonstrated. Moreover, MT-III-induced COX-2 protein expression and PGE2 release were attenuated by pretreatment of macrophages with SB202190, and Ly294002, and H-7-dihydro compounds, indicating the involvement of p38MAPK, PI3K, and PKC pathways, respectively. Consistent with this, MT-III triggered early phosphorylation of p38MAPK, PI3K, and PKC. Furthermore, SB202190, H-7-dihydro, but not Ly294002 treatment, abrogated activation of NF-κB induced by MT-III. Altogether, these results show for the first time that the induction of COX-2 protein expression and PGE2 release, which occur via NF-κB activation induced by the sPLA2-MT-III in macrophages, are modulated by p38MAPK and PKC, but not by PI3K signaling proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Knowledge of the major effects governing desorption/ionization efficiency is required for the development and application of ambient mass spectrometry. Although all triacylglycerols (TAG) have the same favorable protonation and cationization sites, their desorption/ionization efficiencies can vary dramatically during easy ambient sonic-spray ionization because of structural differences in the carbon chain. To quantify this somewhat surprising and drastic effect, we have performed a systematic investigation of desorption/ionization efficiencies as a function of unsaturation and length for TAG as well as for diacylglycerols, monoacylglycerols and several phospholipids (PL). Affinities for Na(+) as a function of unsaturation level have also been assayed via comprehensive metadynamics calculations to understand the influence of this phenomenon on the ionization efficiency. The results suggest that dipole-dipole interactions within a carbon chain tuned by unsaturation sites govern ionization efficiency of TAG and PL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

IKK epsilon (IKKε) is induced by the activation of nuclear factor-κB (NF-κB). Whole-body IKKε knockout mice on a high-fat diet (HFD) were protected from insulin resistance and showed altered energy balance. We demonstrate that IKKε is expressed in neurons and is upregulated in the hypothalamus of obese mice, contributing to insulin and leptin resistance. Blocking IKKε in the hypothalamus of obese mice with CAYMAN10576 or small interfering RNA decreased NF-κB activation in this tissue, relieving the inflammatory environment. Inhibition of IKKε activity, but not TBK1, reduced IRS-1(Ser307) phosphorylation and insulin and leptin resistance by an improvement of the IR/IRS-1/Akt and JAK2/STAT3 pathways in the hypothalamus. These improvements were independent of body weight and food intake. Increased insulin and leptin action/signaling in the hypothalamus may contribute to a decrease in adiposity and hypophagia and an enhancement of energy expenditure accompanied by lower NPY and increased POMC mRNA levels. Improvement of hypothalamic insulin action decreases fasting glycemia, glycemia after pyruvate injection, and PEPCK protein expression in the liver of HFD-fed and db/db mice, suggesting a reduction in hepatic glucose production. We suggest that IKKε may be a key inflammatory mediator in the hypothalamus of obese mice, and its hypothalamic inhibition improves energy and glucose metabolism.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed at evaluating whether human papillomavirus (HPV) groups and E6/E7 mRNA of HPV 16, 18, 31, 33, and 45 are prognostic of cervical intraepithelial neoplasia (CIN) 2 outcome in women with a cervical smear showing a low-grade squamous intraepithelial lesion (LSIL). This cohort study included women with biopsy-confirmed CIN 2 who were followed up for 12 months, with cervical smear and colposcopy performed every three months. Women with a negative or low-risk HPV status showed 100% CIN 2 regression. The CIN 2 regression rates at the 12-month follow-up were 69.4% for women with alpha-9 HPV versus 91.7% for other HPV species or HPV-negative status (P < 0.05). For women with HPV 16, the CIN 2 regression rate at the 12-month follow-up was 61.4% versus 89.5% for other HPV types or HPV-negative status (P < 0.05). The CIN 2 regression rate was 68.3% for women who tested positive for HPV E6/E7 mRNA versus 82.0% for the negative results, but this difference was not statistically significant. The expectant management for women with biopsy-confirmed CIN 2 and previous cytological tests showing LSIL exhibited a very high rate of spontaneous regression. HPV 16 is associated with a higher CIN 2 progression rate than other HPV infections. HPV E6/E7 mRNA is not a prognostic marker of the CIN 2 clinical outcome, although this analysis cannot be considered conclusive. Given the small sample size, this study could be considered a pilot for future larger studies on the role of predictive markers of CIN 2 evolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rapidity-odd directed flow (v1) measurements for charged pions, protons, and antiprotons near midrapidity (y=0) are reported in sNN=7.7, 11.5, 19.6, 27, 39, 62.4, and 200 GeV Au+Au collisions as recorded by the STAR detector at the Relativistic Heavy Ion Collider. At intermediate impact parameters, the proton and net-proton slope parameter dv1/dy|y=0 shows a minimum between 11.5 and 19.6 GeV. In addition, the net-proton dv1/dy|y=0 changes sign twice between 7.7 and 39 GeV. The proton and net-proton results qualitatively resemble predictions of a hydrodynamic model with a first-order phase transition from hadronic matter to deconfined matter, and differ from hadronic transport calculations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disconnectivity between the Default Mode Network (DMN) nodes can cause clinical symptoms and cognitive deficits in Alzheimer׳s disease (AD). We aimed to examine the structural connectivity between DMN nodes, to verify the extent in which white matter disconnection affects cognitive performance. MRI data of 76 subjects (25 mild AD, 21 amnestic Mild Cognitive Impairment subjects and 30 controls) were acquired on a 3.0T scanner. ExploreDTI software (fractional Anisotropy threshold=0.25 and the angular threshold=60°) calculated axial, radial, and mean diffusivities, fractional anisotropy and streamline count. AD patients showed lower fractional anisotropy (P=0.01) and streamline count (P=0.029), and higher radial diffusivity (P=0.014) than controls in the cingulum. After correction for white matter atrophy, only fractional anisotropy and radial diffusivity remained significantly lower in AD compared to controls (P=0.003 and P=0.05). In the parahippocampal bundle, AD patients had lower mean and radial diffusivities (P=0.048 and P=0.013) compared to controls, from which only radial diffusivity survived for white matter adjustment (P=0.05). Regression models revealed that cognitive performance is also accounted for by white matter microstructural values. Structural connectivity within the DMN is important to the execution of high-complexity tasks, probably due to its relevant role in the integration of the network.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mesoporous SBA-15 silica with uniform hexagonal pore, narrow pore size distribution and tuneable pore diameter was organofunctionalized with glutaraldehyde-bridged silylating agent. The precursor and its derivative silicas were ibuprofen-loaded for controlled delivery in simulated biological fluids. The synthesized silicas were characterized by elemental analysis, infrared spectroscopy, (13)C and (29)Si solid state NMR spectroscopy, nitrogen adsorption, X-ray diffractometry, thermogravimetry and scanning electron microscopy. Surface functionalization with amine containing bridged hydrophobic structure resulted in significantly decreased surface area from 802.4 to 63.0 m(2) g(-1) and pore diameter 8.0-6.0 nm, which ultimately increased the drug-loading capacity from 18.0% up to 28.3% and a very slow release rate of ibuprofen over the period of 72.5h. The in vitro drug release demonstrated that SBA-15 presented the fastest release from 25% to 27% and SBA-15GA gave near 10% of drug release in all fluids during 72.5 h. The Korsmeyer-Peppas model better fits the release data with the Fickian diffusion mechanism and zero order kinetics for synthesized mesoporous silicas. Both pore sizes and hydrophobicity influenced the rate of the release process, indicating that the chemically modified silica can be suggested to design formulation of slow and constant release over a defined period, to avoid repeated administration.