Teores de nutrientes na alface irrigada com água residuária aplicada por sistemas de irrigação

A trial was carried out to evaluate the chemical composition in the aerial part of lettuce, cv. 'Elisa', irrigated with wastewater treated with constructed wetland and source deposit water, grown on a Rhodic Hapludox Soil, using the irrigation systems sprinkle, subsurface drip and surface drip irrigation. The experiment was carried out from August 17th to October 3rd of 2001 and the chemical analyses of the lettuce were accomplished to 47 days after transplanting of the seedling. The aerial part of the lettuce was analyzed as for the levels of total nitrogen, nitrate, phosphorus, potassium, calcium, magnesium, sulfur, iron, manganese, copper, zinc, sodium, boron, cobalt and molybdenum. The sodium and the sulfur presented higher levels than the maximum suitable in the aerial part of the lettuce and the smallest level of magnesium, while other chemical elements analyzed were normal and appropriate considering the standard for well-nourished plants, not being influenced by the water type. The sodium was the chemical element that presented the highest levels in the aerial part of the lettuce in the treatments irrigated with wastewater, presenting significant difference in relationship to the treatments irrigated with source deposit water in the three irrigation systems. The use of the different irrigation systems by the application of wastewater treated with constructed wetland did not interfere in the levels of nutrients in the aerial part of the lettuce.

Caracterização morfológica das sementes e plântulas de seis espécies invasoras do gênero Solanum L

Morphological caracterization of the seeds and seedlings of six weed especies of the genus Solanum L. The seeds of the genus Solanum are very similar, however, the association of their external characteristics with the anatomical features, such as hilum shape, the texture and the type of the seed coat sculptures, as well as the curved (circulated or coiled) shape of the embryo, are parameters of great importance in the taxonomical identification at the species level. It is are presented the morphological descriptions of the genus Solanum and a more detailed description of each studied species in terms of seed and seedling structures, including illustrations and taxonomical keys for the identification of Solanum aculeatissimum Jacq., S. americanum Mill., S. ciliatum Lam., S. sisymbriifolium Lam., S. sordidum Sendt. e S. viarum Dunal. There are also indications of the common names, the type of reproduction and dispersion, the crops in which the species is considered as a weed and the agricultural seeds in which it is found as a weed seed.

Germinação e crescimento de Calophyllum brasiliense (Clusiaceae), uma espécie típica de florestas inundadas

Soil waterlogging and the subsequent reduction in the amount of oxygen available for the respiration of the root system selected, along the evolutive process, plants able to thrive in seasonally or permanently flooded areas. In neotropical plants there are many types of adaptations to flooding. In this paper we present the results of the work carried out with seeds and seedlings of C brasiliense subjected to hypoxia during germination and early development. C brasiliense seeds are not photoblastic and survive up to three months burried in a water saturated substrate, but germination only takes place in well-drained soils. Soil waterlogging does not inhibit seedling growth and there are no apparent morphological changes of the aerial part of flooded plants. New and aerated roots that make plant survival possible replace old and spoiled roots. In contrast to many typical species of flood-prone areas where growth is inhibited by oxygen stress. C. brasiliense seedlings seem to be well adapted to their waterlogged environment. Seed dispersion, the absence of photoblastic response as well as seed and seedling capacity of surviving and growing in waterlogged soils contribute to the wide geographic distribution of C. brasiliense always associated with areas subjected to soil waterlogging.

Morfologia de plântulas de cinco leguminosas genistóides arbóreas do Brasil (Leguminosae-Papilionoideae)

This work aims to describe, illustrate and compare the seedling morphology of five tree species of the genera Bowdichia, Cyclolobium, Diplotropis, Ormosia, and Poecilanthe, which belong to the genistoid clade (Leguminosae Papilionoideae). Phanero-epigeal-foliaceous seedlings are found in Bowdichia virgilioides Kunth, Cyclolobium brasiliense Benth. has phanero-epigeal-reserve seedlings, while Ormosia arborea (Vell.) Harms, Diplotropis martiusii Benth., and Poecilanthe parviflora Benth. possess crypto-hypogeal-reserve seedlings. Some other relevant seedling morphological characters are discussed and compared with those of previously studied species in these genera.

Thermolysed and active yeast to reduce the toxicity of aflatoxin

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.