Long-term Decline Of The Amazon Carbon Sink.

Atmospheric carbon dioxide records indicate that the land surface has acted as a strong global carbon sink over recent decades, with a substantial fraction of this sink probably located in the tropics, particularly in the Amazon. Nevertheless, it is unclear how the terrestrial carbon sink will evolve as climate and atmospheric composition continue to change. Here we analyse the historical evolution of the biomass dynamics of the Amazon rainforest over three decades using a distributed network of 321 plots. While this analysis confirms that Amazon forests have acted as a long-term net biomass sink, we find a long-term decreasing trend of carbon accumulation. Rates of net increase in above-ground biomass declined by one-third during the past decade compared to the 1990s. This is a consequence of growth rate increases levelling off recently, while biomass mortality persistently increased throughout, leading to a shortening of carbon residence times. Potential drivers for the mortality increase include greater climate variability, and feedbacks of faster growth on mortality, resulting in shortened tree longevity. The observed decline of the Amazon sink diverges markedly from the recent increase in terrestrial carbon uptake at the global scale, and is contrary to expectations based on models.

Meningencefalites bacterianas agudas em crianças: complicações e sequelas neurológicas

We studied 271 children under age of 15 with diagnosis of acute bacterial meningencephalitis treated at Medical School in Ribeirão Preto, University of São Paulo, between 1980 and 1990. The patients were divided in two groups: 1) those who had not received previous antibiotics treatment (NTP), with 153 cases; and 2), those who had received previous antibiotics treatment (PT), with 118 cases. The etiological agent was more frequently identified in NPT group, while ventriculitis was more frequent in PT group. Mortality rate accounted for 19,5% of all cases, and 29.7% of children under 12 months of age. Acute meningitis caused by Streptococcus pneumoniae was frequently followed by increased mortality. Convulsive disorders and hemiparesis predominante among children under 12 months of age. On the neurosurgical point of view, ventriculitis, subdural hygroma, hydrocephalus, subdural empyema and brain abscess were identified and treated

A responsabilidade de traduzir o in-traduzível: Jacques Derrida e o desejo de [la] tradução

How should one consider the responsibility of the translator, who is located between the differences of two linguistic systems and in the middle of the various idioms constitute each of the languages involved in the translation? (P. Ottoni). What is the role of the translator in inter-acting with both his/her mother tongue and the idiom of the other? These two questions will be discussed in order to reflect on the responsibility of translating the un-translatable. Two hypotheses orient the paper: 1 - an idiom spoken idiomatically is known as the mother tongue and is not appropriated, so that accommodating the other in one's own language automatically considers his/her idiom (J. Derrida) and 2 - face-to-face with language and its idioms, the translator is trapped in a double (responsibility) bind; faced with something which cannot be translated, he/she is forced to perceive it in another way. In conclusion, how should one consider the responsibility of translating the un-translatable Jacques Derrida?

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Candidíase sistêmica com localização encefálica: estudo anátomo-clínico de cinco casos

Central nervous system involvement in Candida septicaemia is rare and not more than four cases have been published in Brazil. Five new cases of systemic candidiasis with cerebral lesions are reported. All patients (four adults and a child) had serious underlying diseases and were submitted to heavy long-term antibiotic therapy with multiple drugs. Seizures in one case and neck stiffness in another were the only neurologic signs that could be attributed to candidiasis. In no case were the lesions severe enough to be considered an immediate cause of death. In three patients, no macroscopic changes were evident in the brain, but microabscesses and granulomata were observed on microscopical examination; another patient had two gross areas with necrotic and haemorrhagic appearance in the cerebral hemispheres; the child had only two microscopic granulomata. The aetiological agent was demonstrated by Grocott's methenamine silver technique in all cases. Involvement of organs other than the central nervous system could be demonstrated in three autopsies. Discussion is confined mainly to such aspects as the contributory factors in the pathogenesis of systemic candidiasis as well as the marked rise in the incidence of this condition in the past few decades. It is suggested that the frequence of monilial septicaemia in Brazil may be far more serious than apparent from the scarcity of reported cases.

Brincando no ambiente natural : uma contribuição para o desenvolvimento sensorio-motor da criança portadora de paralisia cerebral

Universidade Estadual de Campinas . Faculdade de Educação Física

Os sentidos da dança : construção de identidades de dança a partir da experiencia com o ?por qua? grupo experimental de dança

Universidade Estadual de Campinas . Faculdade de Educação Física

Homo-motor, ciborgues e... aha! pessoas : da revolução industrial a revolução da informação

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica adaptada : proposta de ação metodologica para formação universitaria

Universidade Estadual de Campinas. Faculdade de Educação Física

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Tônus muscular : uma contribuição para os estudos em imagem corporal

Universidade Estadual de Campinas . Faculdade de Educação Física

Vivencias corporais na escola : uma experiencia com professores de educação infantil e das quatro series iniciais do ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

Modificações morfo-funcionais do tecido muscular induzidas pela atividade excentrica : um estudo global dos processos adaptativos

Universidade Estadual de Campinas . Faculdade de Educação Física

A pratica do basquetebol feminino no estado de São Paulo : conhecendo e analisando seu contexto

Universidade Estadual de Campinas . Faculdade de Educação Física