11 resultados para 3D shape detection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The reconstruction of the external ear to correct congenital deformities or repair following trauma remains a significant challenge in reconstructive surgery. Previously, we have developed a novel approach to create scaffold-free, tissue engineering elastic cartilage constructs directly from a small population of donor cells. Although the developed constructs appeared to adopt the structural appearance of native auricular cartilage, the constructs displayed limited expression and poor localization of elastin. In the present study, the effect of growth factor supplementation (insulin, IGF-1, or TGF-β1) was investigated to stimulate elastogenesis as well as to improve overall tissue formation. Using rabbit auricular chondrocytes, bioreactor-cultivated constructs supplemented with either insulin or IGF-1 displayed increased deposition of cartilaginous ECM, improved mechanical properties, and thicknesses comparable to native auricular cartilage after 4 weeks of growth. Similarly, growth factor supplementation resulted in increased expression and improved localization of elastin, primarily restricted within the cartilaginous region of the tissue construct. Additional studies were conducted to determine whether scaffold-free engineered auricular cartilage constructs could be developed in the 3D shape of the external ear. Isolated auricular chondrocytes were grown in rapid-prototyped tissue culture molds with additional insulin or IGF-1 supplementation during bioreactor cultivation. Using this approach, the developed tissue constructs were flexible and had a 3D shape in very good agreement to the culture mold (average error <400 µm). While scaffold-free, engineered auricular cartilage constructs can be created with both the appropriate tissue structure and 3D shape of the external ear, future studies will be aimed assessing potential changes in construct shape and properties after subcutaneous implantation.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The cranial base, composed of the midline and lateral basicranium, is a structurally important region of the skull associated with several key traits, which has been extensively studied in anthropology and primatology. In particular, most studies have focused on the association between midline cranial base flexion and relative brain size, or encephalization. However, variation in lateral basicranial morphology has been studied less thoroughly. Platyrrhines are a group of primates that experienced a major evolutionary radiation accompanied by extensive morphological diversification in Central and South America over a large temporal scale. Previous studies have also suggested that they underwent several evolutionarily independent processes of encephalization. Given these characteristics, platyrrhines present an excellent opportunity to study, on a large phylogenetic scale, the morphological correlates of primate diversification in brain size. In this study we explore the pattern of variation in basicranial morphology and its relationship with phylogenetic branching and with encephalization in platyrrhines. We quantify variation in the 3D shape of the midline and lateral basicranium and endocranial volumes in a large sample of platyrrhine species, employing high-resolution CT-scans and geometric morphometric techniques. We investigate the relationship between basicranial shape and encephalization using phylogenetic regression methods and calculate a measure of phylogenetic signal in the datasets. The results showed that phylogenetic structure is the most important dimension for understanding platyrrhine cranial base diversification; only Aotus species do not show concordance with our molecular phylogeny. Encephalization was only correlated with midline basicranial flexion, and species that exhibit convergence in their relative brain size do not display convergence in lateral basicranial shape. The evolution of basicranial variation in primates is probably more complex than previously believed, and understanding it will require further studies exploring the complex interactions between encephalization, brain shape, cranial base morphology, and ecological dimensions acting along the species divergence process.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física