126 resultados para Poster científico


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.