269 resultados para Developed StockMarkets


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Subclinical hypothyroidism (SCH), defined as elevated concentrations of thyroid stimulating hormone (TSH) despite normal levels of thyroid hormones, is highly prevalent in Brazil, especially among women and the elderly. Although an increasing number of studies have related SCH to an increased risk of coronary artery disease and mortality, there have been no randomized clinical trials verifying the benefit of levothyroxine treatment in reducing these risks, and the treatment remains controversial. OBJECTIVE: This consensus, sponsored by the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism and developed by Brazilian experts with extensive clinical experience with thyroid diseases, presents these recommendations based on evidence for the clinical management of SCH patients in Brazil. MATERIALS AND METHODS: After structuring the clinical questions, the search for evidence in the literature was initially performed in the MedLine-PubMed database and later in the Embase and SciELO - Lilacs databases. The strength of evidence was evaluated according to the Oxford classification system and established based on the experimental design used, considering the best available evidence for each question and the Brazilian experience. RESULTS: The topics covered included SCH definition and diagnosis, natural history, clinical significance, treatment and pregnancy, and the consensus issued 29 recommendations for the clinical management of adult patients with SCH. CONCLUSION: Treatment with levothyroxine was recommended for all patients with persistent SCH with serum TSH values > 10 mU/L and for certain patient subgroups.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Myxedema coma, a rare but fatal emergency, is an extreme expression of hypothyroidism. We describe a 51-year-old male patient who has discontinued hypothyroidism treatment 10 months earlier and developed lethargy, edema, and cold intolerance symptoms. He also had a previous diagnosis of neurofibromatosis. After admission, he progressed to respiratory insufficiency and coma. The prompt recognition of the condition, thyroid hormone replacement, and management of the complications (hypoventilation, cardiogenic shock associated with swinging heart, adrenal and renal insufficiency and sepsis), resulted in a favorable evolution.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper describes a topiramate induced acute bilateral angle-closure glaucoma. This rare adverse effect is an idiosyncratic reaction characterized by uveal effusion and lens forward displacement, leading to increased intraocular pressure and vision loss. We describe a 55 year-old white woman with migraine, spasmodic torticollis and essential tremor, who developed bilateral acute angle-closure glaucoma, one week after starting topiramate 25 mg/day. She was seen at the Ophthalmology Emergency Department of the Fundação João Penido Burnier (Campinas, SP, Brazil) with a 4 hours history of blurry vision, ocular pain and bright flashes vision. Slit lamp examination revealed moderate conjunctival injection and corneal edema, and shallow anterior chambers. Intraocular pressure was 48 mmHg in both eyes. Fundoscopic examination findings were normal. She was treated with timolol, brimonidine, dorzolamide, pilocarpine, prednisone acetate eye drops and acetazolamide. One hour after those measures, as the intraocular pressure was 30 mmHg, she received a manitol intravenous injection and the intraocular pressure normalized. After 24 hours an iridotomy with Yag laser was performed. Topiramate was discontinued and she was totally recovered after one week.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The cases of nine pacients with intracranial abscess operated on by aspiration are reported. Only one patient did not survive. One pacient developed postoperative seizures and, another, hemiparesis. In 5 cases it was necessary a relief of increased intracranial pressure by neurosurgical emergency.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A 6 month-old mulatto boy was admitted on account of acute gastroenteritis, malnutrition and dehydration. In the hospital, the child developed septicemia, and temperature reached up to 38.6°C. Despite intensive antibiotic treatment, the patient died 12 days after admission. Necropsy disclosed bilateral bronchopneumonia, bilateral fronto-parietal subarachnoid hemorrhage, and extensive necrosis of the inferior half of both cerebellar hemispheres. On histopathological examination of the necrotic cerebellar cortex, numerous sickled erythrocytes were observed in petechial hemorrhages and, in lesser quantities, inside capillaries. Lesions of the central nervous system in sickle cell anemia most often involve the cerebral cortex, and a single extensive cerebellar infarction as present in this case seems extremely rare. The pathogenetic mechanism of the necrosis is unclear, since thrombosis was not observed either in large blood vessels or in capillaries. Possible contributory factors were the infectious condition (septicemia), fever, and anoxia caused by the extensive bronchopneumonia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A case of brain abscess and meningitis due to pigmented fungi is reported. The patient was a 59-year-old white male, who had enjoyed excellent health until October 1977, when he developed headache, later accompanied by paresthesias and weakness in the left-sided extremities. These symptoms worsened progressively and in November of that year he had to quit his job. From February 1978 on he became inactive and anorexic. Intense continuous headache was associated with frequent episodes of vomiting. He gradually became tor-porous, and according to his relatives, suffered from visual and possibly auditory deficiency. On examination, he was malnourished and dehydrated, with decubitus ulcers. Temperature was 38,5°C. A left-sided spastic hemiplegia and prominent meningorradicular signs were noted. The CSF was examined six times between May 17th and June 1st and showed variable hypercytosis (143 to 4,437 leucocytes/ cu mm) with predominance of neutrophils (up tp 95%), low glucose and high protein concentrations. No microorganisms were identified. Electroencephalographic study disclosed a low background activity especially in left temporal areas. Despite supportive care and antibiotic therapy he lapsed into coma. Carotid angiography was normal on June 1st. He remained in deep coma until his death on June 6th, 1978. Necropsy was limited to the brain, which weighed 1,550 g after fixation and showed diffuse intense edema and hyperemia. On coronal sectioning an encapsulated abscess was found in the right basal ganglia, which also involved the internal capsule, and measured 1.5 cm in diameter. Microscopical examination disclosed large numbers of brownish fungi, appearing both as oval yeasts and as septate hyphae in the thick fibrous capsule and in the necrotic content of the abscess. The same organisms were demonstrated in moderate numbers in the leptomeninges of the medulla oblongata and , less frequently, of the hippo-campal region and cerebellum.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The authors describe a family with three members affected by glioblastoma. The proband patient, a 7 year-old girl, developed a rare complication, a pulmonary metastasis. Chromosomal analysis of her peripheral blood lymphocytes showed a normal karyotype (46, XX), without structural abnormalities. Cytogenetic study of the tumor cells disclosed several abnormalities: 46, XX, 7q - / 46, XX, -2, 4p-, 7p-, +15/ 46, XX. Some aspects about genetics of glial neoplasms are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física