Physical Activity Interventions For Children And Youth With Visual Impairments.

The authors conducted a systematic literature review on physical activity interventions for children and youth with visual impairment (VI). Five databases were searched to identify studies involving the population of interest and physical activity practices. After evaluating 2,495 records, the authors found 18 original full-text studies published in English they considered eligible. They identified 8 structured exercise-training studies that yielded overall positive effect on physical-fitness and motor-skill outcomes. Five leisure-time-physical-activity and 5 instructional-strategy interventions were also found with promising proposals to engage and instruct children and youth with VI to lead an active lifestyle. However, the current research on physical activity interventions for children and youth with VI is still limited by an absence of high-quality research designs, low sample sizes, use of nonvalidated outcome measures, and lack of generalizability, which need to be addressed in future studies.

Antitumor Activity Of Irradiated Riboflavin On Human Renal Carcinoma Cell Line 786-o.

Riboflavin (vitamin B2) is a precursor for coenzymes involved in energy production, biosynthesis, detoxification, and electron scavenging. Previously, we demonstrated that irradiated riboflavin (IR) has potential antitumoral effects against human leukemia cells (HL60), human prostate cancer cells (PC3), and mouse melanoma cells (B16F10) through a common mechanism that leads to apoptosis. Hence, we here investigated the effect of IR on 786-O cells, a known model cell line for clear cell renal cell carcinoma (CCRCC), which is characterized by high-risk metastasis and chemotherapy resistance. IR also induced cell death in 786-O cells by apoptosis, which was not prevented by antioxidant agents. IR treatment was characterized by downregulation of Fas ligand (TNF superfamily, member 6)/Fas (TNF receptor superfamily member 6) (FasL/Fas) and tumor necrosis factor receptor superfamily, member 1a (TNFR1)/TNFRSF1A-associated via death domain (TRADD)/TNF receptor-associated factor 2 (TRAF) signaling pathways (the extrinsic apoptosis pathway), while the intrinsic apoptotic pathway was upregulated, as observed by an elevated Bcl-2 associated x protein/B-cell CLL/lymphoma 2 (Bax/Bcl-2) ratio, reduced cellular inhibitor of apoptosis 1 (c-IAP1) expression, and increased expression of apoptosis-inducing factor (AIF). The observed cell death was caspase-dependent as proven by caspase 3 activation and poly(ADP-ribose) polymerase-1 (PARP) cleavage. IR-induced cell death was also associated with downregulation of v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (avian)/protein serine/threonine kinase B/extracellular signal-regulated protein kinase 1/2 (Src/AKT/ERK1/2) pathway and activation of p38 MAP kinase (p38) and Jun-amino-terminal kinase (JNK). Interestingly, IR treatment leads to inhibition of matrix metalloproteinase-2 (MMP-2) activity and reduced expression of renal cancer aggressiveness markers caveolin-1, low molecular weight phosphotyrosine protein phosphatase (LMWPTP), and kinase insert domain receptor (a type III receptor tyrosine kinase) (VEGFR-2). Together, these results show the potential of IR for treating cancer.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Photocatalytic Degradation Of Ofloxacin And Evaluation Of The Residual Antimicrobial Activity.

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Theobromine Increases Nad⁺/sirt-1 Activity And Protects The Kidney Under Diabetic Conditions.

Reduction in sirtuin 1 (Sirt-1) is associated with extracellular matrix (ECM) accumulation in the diabetic kidney. Theobromine may reduce kidney ECM accumulation in diabetic rats. In the current study, we aimed to unravel, under diabetic conditions, the mechanism of kidney ECM accumulation induced by a reduction in Sirt-1 and the effect of theobromine in these events. In vitro, we used immortalized human mesangial cells (iHMCs) exposed to high glucose (HG; 30 mM), with or without small interfering RNA for NOX4 and Sirt-1. In vivo, spontaneously hypertensive rats (SHR) were rendered diabetic by means of streptozotocin and studied after 12 wk. The effects of treatment with theobromine were investigated under both conditions. HG leads to a decrease in Sirt-1 activity and NAD(+) levels in iHMCs. Sirt-1 activity could be reestablished by treatment with NAD(+), silencing NOX4, and poly (ADP-ribose) polymerase-1 (PARP-1) blockade, or with theobromine. HG also leads to a low AMP/ATP ratio, acetylation of SMAD3, and increased collagen IV, which is prevented by theobromine. Sirt-1 or AMPK blockade abolished these effects of theobromine. In diabetic SHR, theobromine prevented increases in albuminuria and kidney collagen IV, reduced AMPK, elevated NADPH oxidase activity and PARP-1, and reduced NAD(+) levels and Sirt-1 activity. These results suggest that in diabetes mellitus, Sirt-1 activity is reduced by PARP-1 activation and NAD(+) depletion due to low AMPK, which increases NOX4 expression, leading to ECM accumulation mediated by transforming growth factor (TGF)-β1 signaling. It is suggested that Sirt-1 activation by theobromine may have therapeutic potential for diabetic nephropathy.

Imatinib Restores Vasp Activity And Its Interaction With Zyxin In Bcr-abl Leukemic Cells.

Vasodilator-stimulated phosphoprotein (VASP) and Zyxin are interacting proteins involved in cellular adhesion and motility. PKA phosphorylates VASP at serine 157, regulating VASP cellular functions. VASP interacts with ABL and is a substrate of the BCR-ABL oncoprotein. The presence of BCR-ABL protein drives oncogenesis in patients with chronic myeloid leukemia (CML) due to a constitutive activation of tyrosine kinase activity. However, the function of VASP and Zyxin in BCR-ABL pathway and the role of VASP in CML cells remain unknown. In vitro experiments using K562 cells showed the involvement of VASP in BCR-ABL signaling. VASP and Zyxin inhibition decreased the expression of anti-apoptotic proteins, BCL2 and BCL-XL. Imatinib induced an increase in phosphorylation at Ser157 of VASP and decreased VASP and BCR-ABL interaction. VASP did not interact with Zyxin in K562 cells; however, after Imatinib treatment, this interaction was restored. Corroborating our data, we demonstrated the absence of phosphorylation at Ser157 in VASP in the bone marrow of CML patients, in contrast to healthy donors. Phosphorylation of VASP on Ser157 was restored in Imatinib responsive patients though not in the resistant patients. Therefore, we herein identified a possible role of VASP in CML pathogenesis, through the regulation of BCR-ABL effector proteins or the absence of phosphorylation at Ser157 in VASP.

Antimycobacterial and cytotoxicity activity of synthetic and natural compounds

Antimycobacterial and cytotoxicity activity of synthetic and natural compounds. Secondary metabolites from Curvularia eragrostidis and Drechslera dematioidea, Clusia sp. floral resin, alkaloids from Pilocarpus alatus, salicylideneanilines, piperidine amides, the amine 1-cinnamylpiperazine and chiral pyridinium salts were assayed on Mycobacterium tuberculosis H37Rv. N-(salicylidene)-2-hydroxyaniline was the most effective compound with a minimal inhibitory concentration (MIC) of 8 µmol/L. Dihydrocurvularin was moderately effective with a MIC of 40 µmol/L. Clusia sp. floral resin and a gallocatechin-epigallocatechin mixture showed MIC of 0.02 g/L and 38 µmol/L, respectively. The cytotoxicity was evaluated for N-(salicylidene)-2-hydroxyaniline, curvularin, dihydrocurvularin and Clusia sp. floral resin, and the selectivity indexes were > 125, 0.47, 0.75 and 5, respectively.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

Aspectos motores da Paralisia Cerebral Espástica diparética : o Nintendo WII 'MARCA REGISTRADA' como atividade motora complementar = Motor aspects of Spastic Cerebral Palsy : the Nintendo WII 'TRADEMARK' as a supplementary motor activity

Universidade Estadual de Campinas . Faculdade de Educação Física