Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Aspecto tumoral da cisticercose intracraniana: abordagem cirúrgica

The cerebral cysticercosis can produce intracranial hypertension by inflammatory obstruction of the basal cysterns or by expansive lesion in the cerebral parenchima or ventricular cavities. In the latter and in tumor cases the clinical picture is very similar and only after surgery can the etiology be determined. We present 11 operated cases of intracranial cysticercosis which presented the clinical picture of an expansive lesion. There were 7 females and 4 males with ages between 4 and 65 years. Nine patients were admitted because of headache, vomiting and visual disturbances suggestive of intracranial hypertension. One patient was admited with lymphocytic meningitis and another with focal seizures following hemiparesis. Five patients presented focal signs and six edema of the papilla. Epileptic manifestations were present in 45.5% of the cases. A plain X-ray films of the skull failed to reveal calcificatons, however signs of chronic hypertension were present in three cases. The electroencephalogram showed slow focal waves in 8 patients The spinal fluid examination revealed lymphocytosis in 4 cases, increased protein content in another 4 and complement fixation for cysticercosis was positive in 2 cases. The expansive lesions were localized by angiograph and ventriculography. In these the location was temporal in 4, frontal in 3, parietal in 2, in the third ventricle in one and in the fourth ventricle in another. At surgery we removed a large cyst from the cerebral parenchyma in six cases. Around the cyst a thick glial reaction was present. In the other cases the cyst was small but fixed to the ventricular trigone and produced dilatation of the inferior horn of the lateral ventricle. In two cases we removed a solitary intraventricular cyst from the third and fourth ventricles. In the two children operated upon there were several small hard cysts involving the cerebral parenchyma which displayed intense gliosis. There were no postoperative complications.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física

Determinação da velolcidade critica como referencia do limiar anaerobio para o nado costas

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para descrição da orientação do corpo humano

Universidade Estadual de Campinas. Faculdade de Educação Física

Brincando no ambiente natural : uma contribuição para o desenvolvimento sensorio-motor da criança portadora de paralisia cerebral

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade fisica e saude : estudo do conhecimento de professores de educação fisica do ensino fundamental atraves da educação a distancia

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos do estresse fisico no processamento das informações visuais perifericas em motoristas do transporte coletivo urbano

Universidade Estadual de Campinas. Faculdade de Educação Física

Efeito de 24 semanas de treinamento com pesos sobre a composição corporal e indicadores de força muscular

Universidade Estadual de Campinas . Faculdade de Educação Física

A eficacia e a heterocronia das respostas de adaptação de basquetebolistas submetidos a diferentes modelos de estruturação da carga de treinamento e competição

Universidade Estadual de Campinas . Faculdade de Educação Física

Comportamento da ativação dos musculos : reto femoral, vasto lateral e vasto medial durante a realização do movimento de extensão do joelho

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia de esporte : aspectos motriz de aprendizagem em hoquei em patins, crianças de oito a dez anos

Universidade Estadual de Campinas. Faculdade de Educação Física

Desenvolvimento de ferramentas de análise de desempenho de atletas em 3 diferentes modalidades : Handebol, Provas Combinadas e Salto com Vara

Universidade Estadual de Campinas. Faculdade de Educação Física

Aspectos motores da Paralisia Cerebral Espástica diparética : o Nintendo WII 'MARCA REGISTRADA' como atividade motora complementar = Motor aspects of Spastic Cerebral Palsy : the Nintendo WII 'TRADEMARK' as a supplementary motor activity

Universidade Estadual de Campinas . Faculdade de Educação Física