31 resultados para PMC detection model
Resumo:
Primary X-ray spectra were measured in the range of 80-150kV in order to validate a computer program based on a semiempirical model. The ratio between the characteristic and total air Kerma was considered to compare computed results and experimental data. Results show that the experimental spectra have higher first HVL and mean energy than the calculated ones. The ratios between the characteristic and total air Kerma for calculated spectra are in good agreement with experimental results for all filtrations used.
Exercise Increases Pancreatic β-cell Viability In A Model Of Type 1 Diabetes Through Il-6 Signaling.
Resumo:
Type 1 diabetes (T1D) is provoked by an autoimmune assault against pancreatic β cells. Exercise training enhances β-cell mass in T1D. Here, we investigated how exercise signals β cells in T1D condition. For this, we used several approaches. Wild-type and IL-6 knockout (KO) C57BL/6 mice were exercised. Afterward, islets from control and trained mice were exposed to inflammatory cytokines (IL-1β plus IFN-γ). Islets from control mice and β-cell lines (INS-1E and MIN6) were incubated with serum from control or trained mice or medium obtained from 5-aminoimidazole-4 carboxamide1-β-d-ribofuranoside (AICAR)-treated C2C12 skeletal muscle cells. Subsequently, islets and β cells were exposed to IL-1β plus IFN-γ. Proteins were assessed by immunoblotting, apoptosis was determined by DNA-binding dye propidium iodide fluorescence, and NO(•) was estimated by nitrite. Exercise reduced 25, 75, and 50% of the IL-1β plus IFN-γ-induced iNOS, nitrite, and cleaved caspase-3 content, respectively, in pancreatic islets. Serum from trained mice and medium from AICAR-treated C2C12 cells reduced β-cell death, induced by IL-1β plus IFN-γ treatment, in 15 and 38%, respectively. This effect was lost in samples treated with IL-6 inhibitor or with serum from exercised IL-6 KO mice. In conclusion, muscle contraction signals β-cell survival in T1D through IL-6.-Paula, F. M. M., Leite, N. C., Vanzela, E. C., Kurauti, M. A., Freitas-Dias, R., Carneiro, E. M., Boschero, A. C., and Zoppi, C. C. Exercise increases pancreatic β-cell viability in a model of type 1 diabetes through IL-6 signaling.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
Obesity is associated with insulin resistance and is known to be a risk factor for type-2 diabetes. In obese individuals, pancreatic beta-cells try to compensate for the increased insulin demand in order to maintain euglycemia. Most studies have reported that this adaptation is due to morphological changes. However, the involvement of beta-cell functional adaptations in this process needs to be clarified. For this purpose, we evaluated different key steps in the glucose-stimulated insulin secretion (GSIS) in intact islets from female ob/ob obese mice and lean controls. Obese mice showed increased body weight, insulin resistance, hyperinsulinemia, glucose intolerance and fed hyperglycemia. Islets from ob/ob mice exhibited increased glucose-induced mitochondrial activity, reflected by enhanced NAD(P)H production and mitochondrial membrane potential hyperpolarization. Perforated patch-clamp examination of beta-cells within intact islets revealed several alterations in the electrical activity such as increased firing frequency and higher sensitivity to low glucose concentrations. A higher intracellular Ca(2+) mobilization in response to glucose was also found in ob/ob islets. Additionally, they displayed a change in the oscillatory pattern and Ca(2+) signals at low glucose levels. Capacitance experiments in intact islets revealed increased exocytosis in individual ob/ob beta-cells. All these up-regulated processes led to increased GSIS. In contrast, we found a lack of beta-cell Ca(2+) signal coupling, which could be a manifestation of early defects that lead to beta-cell malfunction in the progression to diabetes. These findings indicate that beta-cell functional adaptations are an important process in the compensatory response to obesity.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
This postdoctoral study on the application of the RIME intervention in women that had undergone mastectomy and were in treatment, aimed to promote psychospiritual and social transformations to improve the quality of life, self-esteem and hope. A total of 28 women participated and were randomized into two groups. Brief Psychotherapy (PB) (average of six sessions) was administered in the Control Group, and RIME (three sessions) and BP (average of five sessions) were applied in the RIME Group. The quantitative results indicated a significant improvement (38.3%) in the Perception of Quality of Life after RIME according to the WHOQOL, compared both to the BP of the Control Group (12.5%), and the BP of the RIME Group (16.2%). There was a significant improvement in Self-esteem (Rosenberg) after RIME (14.6%) compared to the BP of the Control Group (worsened 35.9%), and the BP of the RIME Group (8.3%). The improvement in well-being, considering the focus worked on (Visual Analog Scale), was significant in the RIME Group (bad to good), as well as in the Control Group (unpleasant to good). The qualitative results indicated that RIME promotes creative transformations in the intrapsychic and interpersonal dimensions, so that new meanings and/or new attitudes emerge into the consciousness. It was observed that RIME has more strength of psychic structure, ego strengthening and provides a faster transformation that BP, therefore it can be indicated for crisis treatment in the hospital environment.
Resumo:
6
Resumo:
The objective of this study is to verify the dynamics between fiscal policy, measured by public debt, and monetary policy, measured by a reaction function of a central bank. Changes in monetary policies due to deviations from their targets always generate fiscal impacts. We examine two policy reaction functions: the first related to inflation targets and the second related to economic growth targets. We find that the condition for stable equilibrium is more restrictive in the first case than in the second. We then apply our simulation model to Brazil and United Kingdom and find that the equilibrium is unstable in the Brazilian case but stable in the UK case.
Resumo:
Vaso-occlusion, responsible for much of the morbidity of sickle-cell disease, is a complex multicellular process, apparently triggered by leukocyte adhesion to the vessel wall. The microcirculation represents a major site of leukocyte-endothelial interactions and vaso-occlusive processes. We have developed a biochip with subdividing interconnecting microchannels that decrease in size (40 μm to 10 μm in width), for use in conjunction with a precise microfluidic device, to mimic cell flow and adhesion through channels of sizes that approach those of the microcirculation. The biochips were utilized to observe the dynamics of the passage of neutrophils and red blood cells, isolated from healthy and sickle-cell anemia (SCA) individuals, through laminin or endothelial adhesion molecule-coated microchannels at physiologically relevant rates of flow and shear stress. Obstruction of E-selectin/intercellular adhesion molecule 1-coated biochip microchannels by SCA neutrophils was significantly greater than that observed for healthy neutrophils, particularly in the microchannels of 40-15 μm in width. Whereas SCA red blood cells alone did not significantly adhere to, or obstruct, microchannels, mixed suspensions of SCA neutrophils and red blood cells significantly adhered to and obstructed laminin-coated channels. Results from this in vitro microfluidic model support a primary role for leukocytes in the initiation of SCA occlusive processes in the microcirculation. This assay represents an easy-to-use and reproducible in vitro technique for understanding molecular mechanisms and cellular interactions occurring in subdividing microchannels of widths approaching those observed in the microvasculature. The assay could hold potential for testing drugs developed to inhibit occlusive mechanisms such as those observed in SCA and thrombotic diseases.
Resumo:
Oligodendrocytes and Schwann cells are engaged in myelin production, maintenance and repairing respectively in the central nervous system (CNS) and the peripheral nervous system (PNS). Whereas oligodendrocytes act only within the CNS, Schwann cells are able to invade the CNS in order to make new myelin sheaths around demyelinated axons. Both cells have some limitations in their activities, i.e. oligodendrocytes are post-mitotic cells and Schwann cells only get into the CNS in the absence of astrocytes. Ethidium bromide (EB) is a gliotoxic chemical that when injected locally within the CNS, induce demyelination. In the EB model of demyelination, glial cells are destroyed early after intoxication and Schwann cells are free to approach the naked central axons. In normal Wistar rats, regeneration of lost myelin sheaths can be achieved as early as thirteen days after intoxication; in Wistar rats immunosuppressed with cyclophosphamide the process is delayed and in rats administered cyclosporine it may be accelerated. Aiming the enlightening of those complex processes, all events concerning the myelinating cells in an experimental model are herein presented and discussed.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To analyze if female Wistar rats at 56 weeks of age are a suitable model to study osteoporosis. MATERIALS AND METHODS: Female rats with 6 and 36 weeks of age (n = 8 per group) were kept over a 20-week period and fed a diet for mature rodents complete in terms of Ca, phosphorous, and vitamin D. Excised femurs were measured for bone mass using dual-energy x-ray absorptiometry, morphometry, and biomechanical properties. The following serum mar-kers of bone metabolism were analyzed: parathyroid hormone (PTH), osteocalcin (OC), osteoprotegerin (OPG), receptor activator of nuclear factor Κappa B ligand (RANKL), C-terminal peptides of type I collagen (CTX-I), total calcium, and alkaline phosphatase (ALP) activity. RESULTS: Rats at 56 weeks of age showed important bone metabolism differences when compared with the younger group, such as, highest diaphysis energy to failure, lowest levels of OC, CTX-I, and ALP, and elevated PTH, even with adequate dietary Ca. CONCLUSION: Rats at 26-week-old rats may be too young to study age-related bone loss, whereas the 56-week-old rats may be good models to represent the early stages of age-related changes in bone metabolism.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física