27 resultados para Molecular-scale periodicity
Resumo:
The cranial base, composed of the midline and lateral basicranium, is a structurally important region of the skull associated with several key traits, which has been extensively studied in anthropology and primatology. In particular, most studies have focused on the association between midline cranial base flexion and relative brain size, or encephalization. However, variation in lateral basicranial morphology has been studied less thoroughly. Platyrrhines are a group of primates that experienced a major evolutionary radiation accompanied by extensive morphological diversification in Central and South America over a large temporal scale. Previous studies have also suggested that they underwent several evolutionarily independent processes of encephalization. Given these characteristics, platyrrhines present an excellent opportunity to study, on a large phylogenetic scale, the morphological correlates of primate diversification in brain size. In this study we explore the pattern of variation in basicranial morphology and its relationship with phylogenetic branching and with encephalization in platyrrhines. We quantify variation in the 3D shape of the midline and lateral basicranium and endocranial volumes in a large sample of platyrrhine species, employing high-resolution CT-scans and geometric morphometric techniques. We investigate the relationship between basicranial shape and encephalization using phylogenetic regression methods and calculate a measure of phylogenetic signal in the datasets. The results showed that phylogenetic structure is the most important dimension for understanding platyrrhine cranial base diversification; only Aotus species do not show concordance with our molecular phylogeny. Encephalization was only correlated with midline basicranial flexion, and species that exhibit convergence in their relative brain size do not display convergence in lateral basicranial shape. The evolution of basicranial variation in primates is probably more complex than previously believed, and understanding it will require further studies exploring the complex interactions between encephalization, brain shape, cranial base morphology, and ecological dimensions acting along the species divergence process.
Resumo:
Herein, we provide new contribution to the mechanisms involved in keratinocytes response to hyperosmotic shock showing, for the first time, the participation of Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP) activity in this event. We reported that sorbitol-induced osmotic stress mediates alterations in the phosphorylation of pivotal cytoskeletal proteins, particularly Src and cofilin. Furthermore, an increase in the expression of the phosphorylated form of LMWPTP, which was followed by an augment in its catalytic activity, was observed. Of particular importance, these responses occurred in an intracellular milieu characterized by elevated levels of reduced glutathione (GSH) and increased expression of the antioxidant enzymes glutathione peroxidase and glutathione reductase. Altogether, our results suggest that hyperosmostic stress provides a favorable cellular environment to the activation of LMWPTP, which is associated with increased expression of antioxidant enzymes, high levels of GSH and inhibition of Src kinase. Finally, the real contribution of LMWPTP in the hyperosmotic stress response of keratinocytes was demonstrated through analysis of the effects of ACP1 gene knockdown in stressed and non-stressed cells. LMWPTP knockdown attenuates the effects of sorbitol induced-stress in HaCaT cells, mainly in the status of Src kinase, Rac and STAT5 phosphorylation and activity. These results describe for the first time the participation of LMWPTP in the dynamics of cytoskeleton rearrangement during exposure of human keratinocytes to hyperosmotic shock, which may contribute to cell death.
Resumo:
The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.
Resumo:
Phosphatases have long been regarded as tumor suppressors, however there is emerging evidence for a tumor initiating role for some phosphatases in several forms of cancer. Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP; acid phosphatase 1 [ACP1]) is an 18 kDa enzyme that influences the phosphorylation of signaling pathway mediators involved in cancer and is thus postulated to be a tumor-promoting enzyme, but neither unequivocal clinical evidence nor convincing mechanistic actions for a role of LMWPTP have been identified. In the present study, we show that LMWPTP expression is not only significantly increased in colorectal cancer (CRC), but also follows a step-wise increase in different levels of dysplasia. Chemical inhibition of LMWPTP significantly reduces CRC growth. Furthermore, downregulation of LMWPTP in CRC leads to a reduced migration ability in both 2D- and 3D-migration assays, and sensitizes tumor cells to the chemotherapeutic agent 5-FU. In conclusion, this study shows that LMWPTP is not only overexpressed in colorectal cancer, but it is correlated with the malignant potential of this cancer, suggesting that this phosphatase may act as a predictive biomaker of CRC stage and represents a rational novel target in the treatment of this disease.
Resumo:
Huntington disease (HD) is a progressive neurodegenerative disorder with autosomal dominant inheritance, characterized by choreiform movements and cognitive impairment. Onset of symptoms is around 40 years of age and progression to death occurs in approximately 10 to 15 years from the time of disease onset. HD is associated with an unstable CAG repeat expansion at the 5' and of the IT15 gene. We have genotyped the CAG repeat in the IT15 gene in 44 Brazilian individuals (42 patients and 2 unaffected family members) belonging to 34 unrelated families thought to segregate HD. We found one expanded CAG allele in 32 individuals (76%) belonging to 25 unrelated families. In these HD patients, expanded alleles varied from 43 to 73 CAG units and normal alleles varied from 18 to 26 CAGs. A significant negative correlation between age at onset of symptoms and size of the expanded CAG allele was found (r=0.6; p=0.0001); however, the size of the expanded CAG repeat could explain only about 40% of the variability in age at onset (r2=0.4). In addition, we genotyped 25 unrelated control individuals (total of 50 alleles) and found normal CAG repeats varying from 16 to 33 units. The percentage of heterozigocity of the normal allele in the control population was 88%. In conclusion, our results showed that not all patients with the HD phenotype carried the expansion at the IT15 gene. Furthermore, molecular diagnosis was possible in all individuals, since no alleles of intermediate size were found. Therefore, molecular confirmation of the clinical diagnosis in HD should be sought in all suspected patients, making it possible for adequate genetic counseling.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.
Resumo:
In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física