28 resultados para Beneficial insects.
Resumo:
To assess the value of vaginal screening cytology after hysterectomy for benign disease. This cross-sectional study used cytology audit data from 2,512,039 screening tests in the metropolitan region of Campinas from 2000 to 2012; the object was to compare the prevalence of abnormal tests in women who had undergone a hysterectomy for benign diseases (n=53,891) to that of women who had had no hysterectomy. Prevalence ratios (95% confidence intervals, 95% CI) were determined, and chi-square analysis, modified by the Cochrane-Armitage test for trend, was used to investigate the effects of age. The prevalence of atypical squamous cells (ASC), low-grade squamous intraepithelial lesion (LSIL), and high-grade squamous intraepithelial lesion or squamous-cell carcinoma (HSIL/SCC) was 0.13%, 0.04% and 0.03%, respectively, in women who had undergone hysterectomy, and 0.93%, 0.51% and 0.26% in women who had not undergone hysterectomy. The prevalence ratios for ASC, LSIL and HSIL/SCC were 0.14 (0.11-0.17), 0.08 (0.06-0.13) and 0.13 (0.08-0.20), respectively, in women with a hysterectomy versus those without. For HSIL/SCC, the prevalence ratios were 0.09 and 0.29, respectively, for women <50 or ≥50years. The prevalence rates in women with a previous hysterectomy showed no significant variation with age. The prevalence rates of ASC, LSIL and HSIL/SCC were significantly lower in women with a previous hysterectomy for benign disease compared with those observed in women with an intact uterine cervix. This study reinforces the view that there is no evidence that cytological screening is beneficial for women who have had a hysterectomy for benign disease.
Resumo:
Genetically modified foods are a major concern around the world due to the lack of information concerning their safety and health effects. This work evaluates differences, at the proteomic level, between two types of crop samples: transgenic (MON810 event with the Cry1Ab gene, which confers resistance to insects) and non-transgenic maize flour commercialized in Brazil. The 2-D DIGE technique revealed 99 differentially expressed spots, which were collected in 2-D PAGE gels and identified via mass spectrometry (nESI-QTOF MS/MS). The abundance of protein differences between the transgenic and non-transgenic samples could arise from genetic modification or as a result of an environmental influence pertaining to the commercial sample. The major functional category of proteins identified was related to disease/defense and, although differences were observed between samples, no toxins or allergenic proteins were found.
Resumo:
In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.
Resumo:
The first days of radioactivity, the discoveries of X-rays, radioactivity, of alpha- and beta- particles and gamma- radiation, of new radioactive elements, of artificial radioactivity, the neutron and positron and nuclear fission are reviewed as well as several adverse historical marks, such as the Manhattan project and some nuclear and radiological accidents. Nuclear energy generation in Brazil and the world, as an alternative to minimize environmental problems, is discussed, as are the medicinal, industrial and food applications of ionizing radiation. The text leads the reader to reflect on the subject and to consider its various aspects with scientific and technological maturity.
Resumo:
Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.
Resumo:
INTRODUCTION: Like in humans, lower amounts of glycogen are present in tissues of diabetic rats. However, training or drugs that lower glycemia can improve the metabolic control. Metformin increased glycogen while decreased glycemia in normal rats stressed by exercise. OBJECTIVE: In this work we investigated if regular exercise and metformin effects improve the metabolism of diabetic rats. METHODS: Alloxan diabetic Wistar rats treated with metformin (DTM) or not (DT) were trained. Training consisted of 20 sessions of 30 min, 5 days a week. Sedentary diabetic rats served as control (SD and SDM). Metformin (5.6 µg/g) was given in the drinking water. After 48 h resting, glucose (mg/dl) and insulin (ng/mL) was measured in plasma and glycogen (mg/100 mg of wet tissue) in liver, soleus and gastrocnemius. RESULTS: Glycemia decreased in DM group from 435±15 to 230±20, in DT group to 143±8.1 and in DTM group to 138±19 mg/dl. DM group had proportional increase in the hepatic glycogen from 1.69±0.22 to 3.53±0.24, and the training increased to 3.36 ± 0.16 mg/100 mg. Metformin induced the same proportional increase in the muscles (soleus from 0.21±0.008 to 0.42±0.03 and gastrocnemius from 0.33±0.02 to 0.46±0.03), while the training promoted increase on gastrocnemius to 0,53 ± 0,03, only. A high interaction was observed in liver (glycogen increased to 6.48±0.34). CONCLUSION: Very small oral doses of metformin and/or, partially restored glycemia in diabetic rats and decreased glycogen in tissues. Its association with an exercise program was beneficial, helping lower glycemia further and increase glycogen stores on liver of diabetic rats.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This study describes the sperm morphology of the mayfly Hexagenia (Pseudeatonica) albivitta (Ephemeroptera). Its spermatozoon measures approximately 30 μm of which 9 μm corresponds to the head. The head is composed of an approximately round acrosomal vesicle and a cylindrical nucleus. The nucleus has two concavities, one in the anterior tip, where the acrosomal vesicle is inserted and a deeper one at its base, where the flagellum components are inserted. The flagellum is composed of an axoneme, a mitochondrion and a dense rod adjacent to the mitochondrion. A centriolar adjunct is also observed surrounding the axoneme in the initial portion of the flagellum and extends along the flagellum for at least 2 μm, surrounding the axoneme in a half-moon shape. The axoneme is the longest component of the flagellum, and it follows the 9+9+0 pattern, with no central pair of microtubules. At the posterior region of the flagellum, the mitochondrion has a dumb-bell shape in cross sections that, together with the rectangular mitochondrial-associated rod, is responsible for the flattened shape of the flagellum. An internal membrane is observed surrounding both mitochondrion and its associated structure.