21 resultados para relação hospedeiro-patógeno
Resumo:
The chronic treatment with phenytoin or the acute intoxication by this drug may cause permanent cerebellar injury with atrophy of cerebellum vermis and hemispheres, which can be detected by neuroimaging studies. The aim of the present study was to investigate the correlation between the dosage and duration of treatment with phenytoin and the occurrence of cerebellar atrophy. Sixty-six patients were studied and had their tomographies analyzed for cerebellar atrophy. Of the 66 patients studied, 18 had moderate/severe atrophy, 15 had mild atrophy and 33 were considered to be normal. The patients with moderate/severe atrophy were those with higher exposure to phenytoin (longer duration of treatment and higher total dosage) showing statistically significant difference when compared to patients with mild atrophy or without atrophy (p=0.02). Further, the patients with moderate/severe atrophy had serum levels of phenytoin statistically higher than those of patients with mild atrophy or without atrophy (p = 0.008). There was no association between other antiepileptic drugs dosage or duration of treatment and degree of cerebellar atrophy. We also found that older patients had cerebellar atrophy more frequently, indicating that age or duration of the seizure disorder may also be important in the determination of cerebellar degeneration in these patients. We conclude that although there is a possibility that repeated seizures contribute to cerebellar damage, long term exposure to phenytoin, particularly in high doses and toxic serum levels, cause cerebellar atrophy.
Resumo:
The copper and cadmium complexation properties in natural sediment suspensions of reservoirs of the Tietê River were studied using the solid membrane copper and cadmium ion-selective electrodes. The complexation and the average conditional stability constants were determined under equilibrium conditions at pH=6.00 ± 0.05 in a medium of 1.0 mol L-1 sodium nitrate, using the Scatchard method. The copper and cadmium electrodes presented Nernstian behavior from 1x10-6 to 1x10-3 mol L-1 of total metal concentration. Scatchard graphs suggest two classes of binding sites for both metals. A multivariate study was done to correlate the reservoirs and the variables: complexation properties, size, total organic carbon, volatile acid sulfide, E II and pH.
Resumo:
Multidrug resistance, MDR is a major obstacle for cancer chemotherapy. MDR can be reversed by drugs that vary in their chemical structure and main biological activity. Many efforts have been done to overcome MDR based on studies of structure-activity relationships and in this review we summarize some aspects of MDR mediated by P-glycoprotein (P-gp), as the most experimentally and clinically tested form of drug resistance. The most significant MDR mechanisms revealed until now are shortly discussed. Physicochemical and structural properties of MDR modulators, measures of the MDR reversal, and QSAR studies are included.
Resumo:
This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física