36 resultados para extrastomatic bodies
Resumo:
Different types of water bodies, including lakes, streams, and coastal marine waters, are often susceptible to fecal contamination from a range of point and nonpoint sources, and have been evaluated using fecal indicator microorganisms. The most commonly used fecal indicator is Escherichia coli, but traditional cultivation methods do not allow discrimination of the source of pollution. The use of triplex PCR offers an approach that is fast and inexpensive, and here enabled the identification of phylogroups. The phylogenetic distribution of E. coli subgroups isolated from water samples revealed higher frequencies of subgroups A1 and B23 in rivers impacted by human pollution sources, while subgroups D1 and D2 were associated with pristine sites, and subgroup B1 with domesticated animal sources, suggesting their use as a first screening for pollution source identification. A simple classification is also proposed based on phylogenetic subgroup distribution using the w-clique metric, enabling differentiation of polluted and unpolluted sites.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Caffeine has already been used as an indicator of anthropogenic impacts, especially the ones related to the disposal of sewage in water bodies. In this work, the presence of caffeine has been correlated with the estrogenic activity of water samples measured using the BLYES assay. After testing 96 surface water samples, it was concluded that caffeine can be used to prioritize samples to be tested for estrogenic activity in water quality programs evaluating emerging contaminants with endocrine disruptor activity.
Resumo:
Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.
Resumo:
This work describes the evaluation of metals and (metallo)proteins in vitreous humor samples and their correlations with some biological aspects in different post-mortem intervals (1-7 days), taking into account both decomposing and non-decomposing bodies. After qualitative evaluation of the samples involving 26 elements, representative metal ions (Fe, Mg and Mo) are determined by inductively coupled plasma mass spectrometry after using mini-vial decomposition system for sample preparation. A significant trend for Fe is found with post-mortem time for decomposing bodies because of a significant increase of iron concentration when comparing samples from bodies presenting 3 and 7 days post-mortem interval. An important clue to elucidate the role of metals is the coupling of liquid chromatography with inductively coupled plasma mass spectrometry for identification of metals linked to proteins, as well as mass spectrometry for the identification of those proteins involved in the post-mortem interval.
Resumo:
Spores of the tropical mosses Pyrrhobryum spiniforme, Neckeropsis undulata and N. disticha were characterized regarding size, number per capsule and viability. Chemical substances were analyzed for P. spiniforme and N. undulata spores. Length of sporophyte seta (spore dispersal ability) was analyzed for P. spiniforme. Four to six colonies per species in each site (lowland and highland areas of an Atlantic Forest; Serra do Mar State Park, Brazil) were visited for the collection of capsules (2008 - 2009). Neckeropsis undulata in the highland area produced the largest spores (ca. 19 µm) with the highest viability. The smallest spores were found in N. disticha in the lowland (ca. 13 µm). Pyrrhobryum spiniforme produced more spores per capsule in the highland (ca. 150,000) than in lowland (ca. 40,000); longer sporophytic setae in the lowland (ca. 64 mm) than in the highland (ca. 43 mm); and similar sized spores in both areas (ca. 16 µm). Spores of N. undulata and P. spiniforme contained lipids and proteins in the cytoplasm, and acid/neutral lipids and pectins in the wall. Lipid bodies were larger in N. undulata than in P. spiniforme. No starch was recorded for spores. Pyrrhobryum spiniforme in the highland area, different from lowland, was characterized by low reproductive effort, but presented many spores per capsule.
Resumo:
Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.
Resumo:
Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A case of neuronal ceroid-lipofuscinosis (NCL) is reported in a 11-year-old girl, whose main symptoms were progressive dementia since the age of 4 years and choreic movements since age 10. Seizures, myoclonus and visual deterioration were absent and optic fundi were normal. A cerebral biopsy disclosed two basic types of stored substance in the cytoplasm of neurons: a) severely balloned nerve cells in cortical layers HI and V contained a non-autofluorescent material, which stained with PAS and Sudan Black B in frozen, but not in paraffin sections; ultrastructurally, these neurons showed abundant corpuscles similar to the membranous cytoplasmic bodies of Tay-Sachs disease and, in smaller amounts, also zebra bodies; b) slightly distended or non-distended neurons in all layers contained lipopigment granules, which were autofluorescent, PAS-positive and sudanophil in both frozen and paraffin sections; their ultrastructure was closely comparable to that of lipofuscin. Similar bodies were found in the swollen segments of axons and in a few astrocytes and endothelial cells. The histochemical and ultrastructural demonstration of large amounts of lipopigments allows a presumptive classification of the case as NCL. However, the presence of involuntary movements, the absence of visual disturbances and the unusual ultrastructural features place the patient into a small heterogeneous group within the NCL. A better classification of such unique instances of the disease must await elucidation of the basic enzymatic defects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física