[effect Of Ropivacaine Combined With Pancuronium On Neuromuscular Transmission And Effectiveness Of Neostigmine And 4-aminopyridine For Blockade Reversal: Experimental Study].

The local anesthetic effects on neuromuscular junction and its influence on blockade produced by nondepolarizing neuromuscular blockers are still under-investigated; however, this interaction has been described in experimental studies and in humans. The aim of this study was to evaluate in vitro the interaction between ropivacaine and pancuronium, the influence on transmission and neuromuscular blockade, and the effectiveness of neostigmine and 4-aminopyridine to reverse the blockade. Rats were divided into groups (n=5) according to the study drug: ropivacaine (5μgmL(-1)); pancuronium (2μg.mL(-1)); ropivacaine+pancuronium. Neostigmine and 4-aminopyridine were used at concentrations of 2μgmL(-1) and 20μgmL(-1), respectively. The effects of ropivacaine on membrane potential and miniature end-plate potential, the amplitude of diaphragm responses before and 60minutes after the addition of ropivacaine (degree of neuromuscular blockade with pancuronium and with the association of pancuronium-ropivacaine), and the effectiveness of neostigmine and 4-aminopyridine on neuromuscular block reversal were evaluated. Ropivacaine did not alter the amplitude of muscle response (the membrane potential), but decreased the frequency and amplitude of the miniature end-plate potential. Pancuronium blockade was potentiated by ropivacaine, and partially and fully reversed by neostigmine and 4-aminopyridine, respectively. Ropivacaine increased the neuromuscular block produced by pancuronium. The complete antagonism with 4-aminopyridine suggests presynaptic action of ropivacaine.

[comparative Study Between Fast And Slow Induction Of Propofol Given By Target-controlled Infusion: Expected Propofol Concentration At The Effect Site. Randomized Controlled Trial].

studies have shown that rate of propofol infusion may influence the predicted propofol concentration at the effect site (Es). The aim of this study was to evaluate the Es predicted by the Marsh pharmacokinetic model (ke0 0.26min(-1)) in loss of consciousness during fast or slow induction. the study included 28 patients randomly divided into two equal groups. In slow induction group (S), target-controlled infusion (TCI) of propofol with plasma, Marsh pharmacokinetic model (ke0 0.26min(-1)) with target concentration (Tc) at 2.0-μg.mL(-1) were administered. When the predicted propofol concentration at the effect site (Es) reached half of Es value, Es was increased to previous Es + 1μg.mL(-1), successively, until loss of consciousness. In rapid induction group (R), patients were induced with TCI of propofol with plasma (6.0μg.ml(-1)) at Es, and waited until loss of consciousness. in rapid induction group, Tc for loss of consciousness was significantly lower compared to slow induction group (1.67±0.76 and 2.50±0.56μg.mL(-1), respectively, p=0.004). the predicted propofol concentration at the effect site for loss of consciousness is different for rapid induction and slow induction, even with the same pharmacokinetic model of propofol and the same balance constant between plasma and effect site.

Síndrome de Rett: estudo retrospectivo e prospectivo de 28 pacientes

From November 1982 to May 1999, 28 children with Rett syndrome were followed-up for a medium period of 6 years and 2 months. Regression of developmental milestones started at the age between 5 and 20 months. Nineteen cases of typical Rett syndrome had uneventful pre and perinatal periods, loss of previously acquired purposeful hand skills, mental and motor regression and developed hand stereotypies; sixteen had head growth deceleration and 12 gait apraxia. Nine patients were atypical cases, 2 formes frustres, 2 congenital, 3 with early seizure onset, 1 preserved speech and 1 male. Epilepsy was present in 21 patients, predominantly partial seizures and the drug of choise was carbamazepine (15 patients). In the initial evaluation most patients were distributed on Stages II and III and on follow-up on Stages III and IV. Three children died.

TEORIA SINTÁTICA: DE UMA PERSPECTIVA DE -ISMOS PARA UMAPERSPECTIVA DE PROGRAMAS

This paper tries to show that the developments in linguistic sciences are better viewed as stages in a single research program, rather than different ideological -isms. The first part contains an overview of the structuralistas' beliefs about the universality and equivalence of human languages, and their search for syntactic universals. In the second part, we will see that the generative program, in its turn, tries to answer why language is a universal faculty in the human species and addresses questions about its form, its development and its use. In the second part, we will see that the paper gives a brief glimpse of the tentative answers the program has been giving to each of these issues.

Adaptação de protocolos invasivos e não invasivos para avaliações aeróbias e anaeróbias específicas ao basquetebol feminino

OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Phenotypic variability in a family with x-linked adrenoleukodystrophy caused by the p.Trp132Ter mutation

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Are skeletally mature female rats a suitable model to study osteoporosis?

OBJECTIVE: To analyze if female Wistar rats at 56 weeks of age are a suitable model to study osteoporosis. MATERIALS AND METHODS: Female rats with 6 and 36 weeks of age (n = 8 per group) were kept over a 20-week period and fed a diet for mature rodents complete in terms of Ca, phosphorous, and vitamin D. Excised femurs were measured for bone mass using dual-energy x-ray absorptiometry, morphometry, and biomechanical properties. The following serum mar-kers of bone metabolism were analyzed: parathyroid hormone (PTH), osteocalcin (OC), osteoprotegerin (OPG), receptor activator of nuclear factor Κappa B ligand (RANKL), C-terminal peptides of type I collagen (CTX-I), total calcium, and alkaline phosphatase (ALP) activity. RESULTS: Rats at 56 weeks of age showed important bone metabolism differences when compared with the younger group, such as, highest diaphysis energy to failure, lowest levels of OC, CTX-I, and ALP, and elevated PTH, even with adequate dietary Ca. CONCLUSION: Rats at 26-week-old rats may be too young to study age-related bone loss, whereas the 56-week-old rats may be good models to represent the early stages of age-related changes in bone metabolism.

Formação empirica na educação superior : um estudo de caso na Faculdade de Educação Fisica da Unicamp

Universidade Estadual de Campinas. Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Suplementação com caldo de cana de açucar comparado com outros carboidratos na reposição do glicogenio e cinetica de biomarcadores pos-exercicio agudo em ratos

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito do treinamento e maturação sexual sobre o crescimento, composição corporal e desempenho motor em adolescentes do sexo masculino

Universidade Estadual de Campinas . Faculdade de Educação Física

A dimensão prática na preparação profissional em educação física : concepção e organização acadêmica

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação da associação de diferentes programas de atividade física aplicados no local de trabalho sobre o nível de atividade física e qualidade de vida de trabalhadores do setor administrativo de comunidade universitária

Universidade Estadual de Campinas . Faculdade de Educação Física

Controle autonomico da frequencia cardiaca de adolescentes em treinamento

Universidade Estadual de Campinas . Faculdade de Educação Física