Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.

Avaliação da velocidade de processamento de processadoras automáticas ultilizado o método "STEP test"

A avaliação do processamento radiográfico utilizando o "STEP test" ("sensitometric test for the evaluation of processing") tem como objetivo a identificação de desvios importantes no sistema processadora-químicos-filmes. Neste tipo de avaliação são estabelecidas as condições ideais para o processamento. Um filme padrão é revelado de acordo com as condições do fabricante, ou seja, com padrão igual a 100. O filme é exposto à luz de um sensitômetro calibrado e os valores dos degraus são avaliados com o uso de um densitômetro, sendo obtida sua curva característica (densidade óptica × degrau). O desvio porcentual máximo deve ser de 20% quando comparado com a curva padrão. Este método é útil na identificação de problemas no processamento radiográfico. Várias processadoras de hospitais públicos/universitários foram avaliadas empregando este método, e verificou-se que aproximadamente 33% das instalações apresentam condições inadequadas de processamento.

Dose calibrator linearity test: 99mTc versus 18F radioisotopes

Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.

Evaluación de la estructura porosa de los materiales MCM-22, MCM-36 e ITQ-2 empleando el test catalitico del n-decano

The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22

Dissolution test for glibenclamide tablets

The aim of this work is to develop and validate a dissolution test for glibenclamide tablets. Optimal conditions to carry out the dissolution test are 500 mL of phosphate buffer at pH 8.0, paddles at 75 rpm stirring speed, time test set to 60 min and using equipment with six vessels. The derivative UV spectrophotometric method for determination of glibenclamide released was developed, validated and compared with the HPLC method. The UVDS method presents linearity (r² = 0.9999) in the concentration range of 5-14 µg/mL. Precision and recoveries were 0.42% and 100.25%, respectively. The method was applied to three products commercially available on the Brazilian market.

Desenvolvimento de um spot test para o monitoramento da atividade da peroxidase em um procedimento de purificação

In this work we describe both a chromatographic purification procedure and a spot test for the enzyme peroxidase (POD: EC 1.11.1.7). The enzyme was obtained from crude extracts of sweet potatoes and the chromatographic enzyme purification procedure resulted in several fractions. Therefore a simple, fast and economic spot test for monitoring peroxidase during the purification procedure was developed. The spot test is based on the reaction of hydrogen peroxide and guaiacol, which is catalyzed by the presence of peroxidase yielding the colored tetraguaiacol.

Development and validation of a dissolution test for telithromycin in coated tablets

A dissolution test for telithromycin tablets was validated and developed. In order to choose the most discriminatory one, the conditions to carry out are 900 mL of sodium phosphate buffer at pH 7.5, paddles at 50 rpm stirring speed, time test set to 60 min and using USP apparatus 2 with paddles. The UV spectrophotometric method for determination of telithromycin released was developed and validated. The method presents linearity (r = 1) in the concentration range of 20-60 µg/mL. Precision and recoveries were good, 100.62 and 97.06%, respectively. The method was successfully used for the dissolution test of telithromycin tablets.

Losartan potassium dissolution test for drug release evaluation in pharmaceutical capsules using HPLC and UV spectrophotometry

This work describes the development and validation of a dissolution test for 50 mg losartan potassium capsules using HPLC and UV spectrophotometry. A 2(4) full factorial design was carried out to optimize dissolution conditions and potassium phosphate buffer, pH 6.8 as dissolution medium, basket as apparatus at the stirring speed of 50 rpm and time of 30 min were considered adequate. Both dissolution procedure and analytical methods were validated and a statistical analysis showed that there are no significant differences between HPLC and spectrophotometry. Since there is no official monograph, this dissolution test could be applied for quality control routine.

Development of new dissolution test and HPLC-RP method for anti-parasitic ornidazole coated tablets

This work aimed the development and validation of a new dissolution test for ornidazole coated tablets. The dissolution conditions were determined after testing Sink conditions, dissolution medium, apparatus, stirring speed, 24 h stability and medium filtration influence. The best conditions were paddle at a stirring speed of 75 rpm and 900 mL of 0.1 M HCl. A new HPLC quantification method was developed and validated. The dissolution test and quantification method showed to be adequate for their purposes and could be applied for quality control of ornidazole coated tablets, since there is no official monograph.

Development and validation of a dissolution test with reversed-phase liquid chromatography analysis for rupatadine in tablet dosage forms

A dissolution test for in vitro evaluation of tablet dosage forms containing 10 mg of rupatadine was developed and validated by RP-LC. A discriminatory dissolution method was established using apparatus paddle at a stirring rate of 50 rpm with 900 mL of deaerated 0.01 M hydrochloric acid. The proposed method was validated yielding acceptable results for the parameters evaluated, and was applied for the quality control analysis of rupatadine tablets, and to evaluate the formulation during an accelerated stability study. Moreover, quantitative analyses were also performed, to compare the applicability of the RP-LC and the LC-MS/MS methods.

Terbinafine: optimization of a LC method for quantitative analysis in pharmaceutical formulations and its application for a tablet dissolution test

A simple liquid chromatographic method was optimized for the quantitative determination of terbinafine in pharmaceutical hydroalcoholic solutions and tablets, and was also employed for a tablet dissolution test. The analysis was carried out using a RP-C18 (250 mm × 4.6 mm, 5 μm) Vertical® column, UV-Vis detection at 254 nm, and a methanol-water (95:5, v/v) mobile phase at a flow-rate of 1.2 mL min-1. Method validation investigated parameters such as linearity, precision, accuracy, robustness and specificity, which gave results within the acceptable range. The tablets dissolution was quite fast: 80% of the drug was dissolved within 15 min.

Development and validation of a dissolution test for diltiazem hydrochloride in immediate release capsules

This work describes the development and validation of a dissolution test for 60 mg of diltiazem hydrochloride in immediate release capsules. The best dissolution in vitro profile was achieved using potassium phosphate buffer at pH 6.8 as the dissolution medium and paddle as the apparatus at 50 rpm. The drug concentrations in the dissolution media were determined by UV spectrophotometry and HPLC and a statistical analysis revealed that there were significant differences between HPLC and spectrophotometry. This study illustrates the importance of an official method for the dissolution test, since there is no official monograph for diltiazem hydrochloride in capsules.

Development and validation of a dissolution test for primaquine/polyethylene oxide matrix tablets

A simple, precise, specific, repeatable and discriminating dissolution test for primaquine (PQ) matrix tablets was developed and validated according to ICH and FDA guidelines. Two UV assaying methods were validated for determination of PQ released in 0.1 M hydrochloric acid and water media. Both methods were linear (R²>0.999), precise (R.S.D.<1.87%) and accurate (97.65-99.97%). Dissolution efficiency (69-88%) and equivalence of formulations (f2) was assessed in different media and apparatuses (basket/100 rpm and paddle/50 rpm) tested. Discriminating condition was 900 mL aqueous medium, basket at 100 rpm and sampling times at 1, 4 and 8 h. Repeatability (R.S.D.<2.71%) and intermediate precision (R.S.D.<2.06%) of dissolution method were satisfactory.

Propuesta de un test para determinar el conocimiento conceptual de estudiantes universitarios sobre la constante de equilibrio químico y su aplicación en estudiantes españoles

This article outlines a procedure that was used to develop a written test for evaluating the conceptual knowledge of chemical equilibrium constant among university students. The concepts in the subject matter were carefully defined through propositional statements. Students' understanding of the topic was determined through interviews. These data were used to produce nine multiple choice questions. Each question was designed to identify misconceptions related to the chemical equilibrium constant. The test was evaluated by foure associate professors and was administred to a total of 196 spanish university students. This test has a Cronbach's alpha reliability of 0.63 and its content validity values ranged from 3.7 to 5.