27 resultados para pigment-protein complexes
em DigitalCommons@The Texas Medical Center
Resumo:
The initial step in coronavirus-mouse hepatitis virus (MHV) replication is the synthesis of negative strand RNA from a positive strand genomic RNA template. Our approach to studying MHV RNA replication is to identify the cis-acting signals for RNA synthesis and the protein(s) which recognizes these signals at the 3$\sp\prime$ end of genomic RNA of MHV. To determine whether host cellular and/or virus-specific proteins interact with the 3$\sp\prime$ end of the coronavirus genome, an RNase T$\sb1$ protection/gel mobility shift electrophoresis assay was used to examine cytoplasmic extracts from either mock- or MHV-JHM-infected 17Cl-1 murine cells for the ability to form complexes with defined regions of the genomic RNA. A conserved 11 nucleotide sequence UGAAUGAAGUU at nucleotide positions 36 to 26 from the 3$\sp\prime$ end of genomic RNA was identified to be responsible for the specific binding of host proteins, by using a series of RNA probes with deletions and mutations in this region. The RNA probe containing the 11 nucleotide sequence bound approximately four host cellular proteins with a highly labeled 120 kDa and three minor species with sizes of 103, 81 and 55 kDa, assayed by UV-induced covalent cross-linking. Mutation of the 11 nucleotide motif strongly inhibited cellular protein binding, and decreased the amount of the 103 and 81 kDa proteins in the complex to undetectable levels and strongly reduced the binding of the 120 kDa protein. Less extensive mutations within this 11 nucleotide motif resulted in variable decreases in RNA-protein complex formation depending on each probe tested. The RNA-protein complexes observed with cytoplasmic extracts from MHV-JHM-infected cells in both RNase protection/gel mobility shift and UV cross-linking assays were indistinguishable to those observed with extracts from uninfected cells.^ To investigate the possible role of this 3$\sp\prime$ protein binding element in viral RNA replication in vivo, defective interfering RNA molecules with complete or partial mutations of the 11 nucleotide conserved sequence were transcribed in vitro, transfected to host 17Cl-1 cells in the presence of helper virus MHV-JHM and analyzed by agarose gel electrophoresis, competitive RT-PCR and direct sequencing of the RT-PCR products. Both negative strand synthesis and positive strand replication of DI RNA were affected by mutation that disrupts RNA-protein complex formation, even though the 11 mutated nucleotides were converted to wild type sequence, presumably by recombination with helper virus. Kinetic analysis indicated that recombination between DI RNA and helper virus occurred 5.5 to 7.5 hours post infection when replication of positive strand DI RNA was barely observed. Replication of positive strand DI RNAs carrying partial mutations within the 11 nucleotide motif was dependent upon recombination events after transfection. Replication was strongly inhibited when reversion to wild type sequence did not occur, and after recombination, reached similar levels as wild type DI RNA. A DI RNA with mutation upstream of the protein binding motif replicated as efficiently as wild type without undergoing recombination. Thus the conserved 11 nucleotide host protein binding motif appears to play an important role in viral RNA replication. ^
Resumo:
MAX dimerization protein 1 (MAD1) is a basic-helix-loop-helix transcription factors that recruits transcription repressor such as HDAC to suppress target genes transcription. It antagonizes to MYC because the promoter binding sites for MYC are usually also serve as the binding sites for MAD1 so they compete for it. However, the mechanism of the switch between MYC and MAD1 in turning on and off of genes' transcription is obscure. In this study, we demonstrated that AKT-mediated MAD1 phosphorylation inhibits MAD1 transcription repression function. The association between MAD1 and its target genes' promoter is reduced after been phosphorylated by AKT; therefore, consequently, allows MYC to occupy the binding site and activates transcription. Mutation of such phosphorylation site abrogates the inhibition from AKT. In addition, functional assays demonstrated that AKT suppressed MAD1-mediated transcription repression of its target genes hTERT and ODC. Cell cycle and cell growth were also been released from inhibition by MAD1 in the presents of AKT. Taken together, our study suggests that MAD1 is a novel substrate of AKT and AKT-mediated MAD1 phosphorylation inhibits MAD1function; therefore, activates MAD1 target genes expression. ^ Furthermore, analysis of protein-protein interaction is indispensable for current molecular biology research, but multiplex protein dynamics in cells is too complicated to be analyzed by using existing biochemical methods. To overcome the disadvantage, we have developed a single molecule level detection system with nanofluidic chip. Single molecule was analyzed based on their fluorescent profile and their profiles were plotted into 2 dimensional time co-incident photon burst diagram (2DTP). From this 2DTP, protein complexes were characterized. These results demonstrate that the nanochannel protein detection system is a promising tool for future molecular biology. ^
Resumo:
In this paper, we present the Cellular Dynamic Simulator (CDS) for simulating diffusion and chemical reactions within crowded molecular environments. CDS is based on a novel event driven algorithm specifically designed for precise calculation of the timing of collisions, reactions and other events for each individual molecule in the environment. Generic mesh based compartments allow the creation / importation of very simple or detailed cellular structures that exist in a 3D environment. Multiple levels of compartments and static obstacles can be used to create a dense environment to mimic cellular boundaries and the intracellular space. The CDS algorithm takes into account volume exclusion and molecular crowding that may impact signaling cascades in small sub-cellular compartments such as dendritic spines. With the CDS, we can simulate simple enzyme reactions; aggregation, channel transport, as well as highly complicated chemical reaction networks of both freely diffusing and membrane bound multi-protein complexes. Components of the CDS are generally defined such that the simulator can be applied to a wide range of environments in terms of scale and level of detail. Through an initialization GUI, a simple simulation environment can be created and populated within minutes yet is powerful enough to design complex 3D cellular architecture. The initialization tool allows visual confirmation of the environment construction prior to execution by the simulator. This paper describes the CDS algorithm, design implementation, and provides an overview of the types of features available and the utility of those features are highlighted in demonstrations.
Resumo:
Cardiolipin (CL) plays a key role in dynamic organization of bacterial and mitochondrial membranes. CL forms membrane domains in bacterial cells, and these domains appear to participate in binding and functional regulation of multi-protein complexes involved in diverse cellular functions including cell division, energy metabolism, and membrane transport. Visualization of CL domains in bacterial cells by the fluorescent dye 10-N-nonyl acridine orange is critically reviewed. Possible mechanisms proposed for CL dynamic localization in bacterial cells are discussed. In the mitochondrial membrane CL is involved in organization of multi-subunit oxidative phosphorylation complexes and in their association into higher order supercomplexes. Evidence suggesting a possible role for CL in concert with ATP synthase oligomers in establishing mitochondrial cristae morphology is presented. Hypotheses on CL-dependent dynamic re-organization of the respiratory chain in response to changes in metabolic states and CL dynamic re-localization in mitochondria during the apoptotic response are briefly addressed.
Resumo:
The H(+)-K(+)-ATPase alpha(2) (HKalpha2) gene of the renal collecting duct and distal colon plays a central role in potassium and acid-base homeostasis, yet its transcriptional control remains poorly characterized. We previously demonstrated that the proximal 177 bp of its 5'-flanking region confers basal transcriptional activity in murine inner medullary collecting duct (mIMCD3) cells and that NF-kappaB and CREB-1 bind this region to alter transcription. In the present study, we sought to determine whether the -144/-135 Sp element influences basal HKalpha2 gene transcription in these cells. Electrophoretic mobility shift and supershift assays using probes for -154/-127 revealed Sp1-containing DNA-protein complexes in nuclear extracts of mIMCD3 cells. Chromatin immunoprecipitation (ChIP) assays demonstrated that Sp1, but not Sp3, binds to this promoter region of the HKalpha2 gene in mIMCD3 cells in vivo. HKalpha2 minimal promoter-luciferase constructs with point mutations in the -144/-135 Sp element exhibited much lower activity than the wild-type promoter in transient transfection assays. Overexpression of Sp1, but not Sp3, trans-activated an HKalpha2 proximal promoter-luciferase construct in mIMCD3 cells as well as in SL2 insect cells, which lack Sp factors. Conversely, small interfering RNA knockdown of Sp1 inhibited endogenous HKalpha2 mRNA expression, and binding of Sp1 to chromatin associated with the proximal HKalpha2 promoter without altering the binding or regulatory influence of NF-kappaB p65 or CREB-1 on the proximal HKalpha2 promoter. We conclude that Sp1 plays an important and positive role in controlling basal HKalpha2 gene expression in mIMCD3 cells in vivo and in vitro.
Resumo:
Deadenylation is the major step triggering mammalian mRNA decay. One consequence of deadenylation is the formation of nontranslatable messenger RNA (mRNA) protein complexes (messenger ribonucleoproteins [mRNPs]). Nontranslatable mRNPs may accumulate in P-bodies, which contain factors involved in translation repression, decapping, and 5'-to-3' degradation. We demonstrate that deadenylation is required for mammalian P-body formation and mRNA decay. We identify Pan2, Pan3, and Caf1 deadenylases as new P-body components and show that Pan3 helps recruit Pan2, Ccr4, and Caf1 to P-bodies. Pan3 knockdown causes a reduction of P-bodies and has differential effects on mRNA decay. Knocking down Caf1 or overexpressing a Caf1 catalytically inactive mutant impairs deadenylation and mRNA decay. P-bodies are not detected when deadenylation is blocked and are restored when the blockage is released. When deadenylation is impaired, P-body formation is not restorable, even when mRNAs exit the translating pool. These results support a dynamic interplay among deadenylation, mRNP remodeling, and P-body formation in selective decay of mammalian mRNA.
Resumo:
Deadenylation is the major step triggering mammalian mRNA decay. One consequence of deadenylation is the formation of nontranslatable messenger RNA (mRNA) protein complexes (messenger ribonucleoproteins [mRNPs]). Nontranslatable mRNPs may accumulate in P-bodies, which contain factors involved in translation repression, decapping, and 5'-to-3' degradation. We demonstrate that deadenylation is required for mammalian P-body formation and mRNA decay. We identify Pan2, Pan3, and Caf1 deadenylases as new P-body components and show that Pan3 helps recruit Pan2, Ccr4, and Caf1 to P-bodies. Pan3 knockdown causes a reduction of P-bodies and has differential effects on mRNA decay. Knocking down Caf1 or overexpressing a Caf1 catalytically inactive mutant impairs deadenylation and mRNA decay. P-bodies are not detected when deadenylation is blocked and are restored when the blockage is released. When deadenylation is impaired, P-body formation is not restorable, even when mRNAs exit the translating pool. These results support a dynamic interplay among deadenylation, mRNP remodeling, and P-body formation in selective decay of mammalian mRNA.
Resumo:
The BCR gene is involved in the pathogenesis of Philadelphia chromosome-positive (Ph$\sp1$) leukemias. Typically, the 5$\sp\prime$ portion of BCR on chromosome 22 becomes fused to a 5$\sp\prime$ truncated ABL gene from chromosome 9 resulting in a chimeric BCR-ABL gene. To investigate the role of the BCR gene product, a number of BCR peptide sequences were used to generate anti-BCR antibodies for detection of BCR and BCR-ABL proteins. Since both BCR and ABL proteins have kinase activity, the anti-BCR antibodies were tested for their ability to immunoprecipitate BCR and BCR-ABL proteins from cellular lysates by use of an immunokinase assay. Antisera directed towards the C-terminal portions of P160 BCR, sequences not present in BCR-ABL proteins, were capable of co-immunoprecipitating P210 BCR-ABL from the Ph$\sp1$- positive cell line K562. Re-immunoprecipitation studies following complete denaturation showed that C-terminal BCR antisera specifically recognized P160 BCR but not P210 BCR-ABL. These and other results indicated the presence of a P160 BCR/P210 BCR-ABL protein complex in K562 cells. Experiments performed with Ph$\sp1$-positive ALL cells and uncultured Ph$\sp1$-positive patient white blood cells established the general presence of BCR/BCR-ABL protein complexes in BCR-ABL expressing cells. However, two cell lines derived from Ph$\sp1$-positive patients lacked P160 BCR/P210 BCR-ABL complexes. Lysates from one of these cell lines mixed with lysates from a cell line that expresses only P160 BCR failed to generate BCR/BCR-ABL protein complexes in vitro indicating that P160 BCR and P210 BCR-ABL do not simply oligomerize.^ Two-dimensional tryptic maps were performed on both BCR and BCR-ABL proteins labeled in vitro with $\sp{32}$P. These maps indicate that the autophosphorylation sites in BCR-ABL proteins are primarily located within BCR exon 1 sequences in both P210 and P185 BCR-ABL, and that P160 BCR is phosphorylated in trans in similar sites by the activated ABL kinase of both BCR-ABL proteins. These results provide strong evidence that P160 BCR serves as a target for the BCR-ABL oncoprotein.^ K562 cells, induced to terminally differentiate with the tumor promoter TPA, show a loss of P210 BCR-ABL kinase activity 12-18 hours after addition of TPA. This loss coincides with the loss of activity in P160 BCR/P210 BCR-ABL complexes but not with the loss of the P210 BCR-ABL, suggesting the existence of an inactive form of P210 BCR-ABL. However, a degraded BCR-ABL protein served as the kinase active form preferentially sequestered within the remaining BCR/BCR-ABL protein complex.^ The results described in this thesis form the basis for a model for BCR-ABL induced leukemias which is presented and discussed. ^
Resumo:
Monocyte developmental heterogeneity is reflected at the cellular level by differential activation competence, at the molecular level by differential regulation of gene expression. LPS activates monocytes to produce tumor necrosis factor-$\alpha$ (TNF). Events occurring at the molecular level necessary for TNF regulation have not been elucidated, but depend both on activation signals and the maturation state of the cell: Peripheral blood monocytes produce TNF upon LPS stimulation, but only within the first 72 hours of culture. Expression of c-fos is associated with monocytic differentiation and activation; the fos-associated protein, c-jun, is also expressed during monocyte activation. Increased cAMP levels are associated with down regulation of macrophage function, including LPS-induced TNF transcription. Due to these associations, we studied a region of the TNF promoter which resembles the binding sites for both AP-1(fos/jun) and CRE-binding protein (or ATF) in order to identify potential molecular markers defining activation competent populations of monocytic cells.^ Nuclear protein binding studies using extracts from THP-1 monocytic cells stimulated with LPS, which stimulates, or dexamethasone (Dex) or pentoxyfilline (PTX), which inhibit TNF production, respectively, suggest that a low mobility doublet complex may be involved in regulation through this promoter region. PTX or Dex increase binding of these complexes equivalently over untreated cells; approximately two hours after LPS induction, the upper complex is undetectable. The upper complex is composed of ATF2 (CRE-BP1); the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun-ATF2 complexes. The simultaneous presence of both complexes may reduce the amount of TNF transcription through competitive binding, while a loss of the upper (ATF2) and/or gain of the lower (jun-ATF2) allow increased transcription. AP-1 elements generally transduce signals involving PKC; the CRE mediates a cAMP response, involving PKA. Thus, this element has the potential of receiving signals through divergent signalling pathways. Our findings also suggest that cAMP-induced inhibition of macrophage functions may occur via down regulation of activation-associated genes through competitive binding of particular cAMP-responsive nuclear protein complexes. ^
Resumo:
Studies to elucidate the function of vitamin D have demonstrated an important role in regulating bone-related cells, including osteoblasts and osteoclasts. A seemingly paradoxical observation is that 1,25(OH)$\sb2$D$\sb3$, the active metabolite of vitamin D, stimulates bone resorption, yet regulates transcription of genes expressed by osteoblasts. One mechanism that could explain these actions is the upregulation of transcription of osteoblast-specific genes. These gene products could then act as effectors to influence osteoclastic activity. We hypothesized that molecular signals could be deposited directly into the mineralized matrix in the form of noncollagenous proteins, such as osteopontin (OPN). The structure, biosynthesis and localization of OPN suggest that it could function to mediate the molecular "cross talk" between osteoblasts and osteoclasts in response to 1,25(OH)$\sb2$D$\sb3$. To begin to address this hypothesis, elucidation of the molecular mechanisms of action involved in the transactivation of OPN by 1,25(OH)$\sb2$D$\sb3$ is essential.^ In the present study, the rat opn gene was isolated and characterized. Functional analysis by transient transfection of the 5$\sp\prime$ flanking sequences of the rat opn gene fused to the luciferase gene demonstrated that OPN is transcriptionally upregulated by 1,25(OH)$\sb2$D$\sb3$, mediated through two vitamin D response elements (VDRE). Both proximal and distal VDREs are structurally similar (two imperfect direct repeats separated by a 3 nucleotide spacer) and bind protein complexes that include the VDR and retinoid-X receptor (RXR). Isolated VDRE expression constructs produce functional activity of equivalent magnitude of responsiveness to 1,25(OH)$\sb2$D$\sb3$. However, expression constructs containing either VDRE and at least 200 bp of 5$\sp\prime$ and 3$\sp\prime$ flanking sequence demonstrated that the distal VDRE produces an amplitude of response significantly higher than the proximal VDRE. We conclude that the transcriptional upregulation of the opn gene by 1,25(OH)$\sb2$D$\sb3$ involves the transactivation of two VDREs, while maximal responsiveness requires interaction of the VDREs with additional cis-elements contained in the 5$\sp\prime$ sequence. ^
Resumo:
PAX6, a member of the paired-type homeobox gene family, is expressed in a partially and temporally restricted pattern in the developing central nervous system, and its mutation is responsible for human aniridia (AN) and mouse small eye (Sey). The objective of this study was to characterize the PAX6 gene regulation at the transcriptional level, and thereby gain a better understanding of the molecular basis of the dynamic expression pattern and the diversified function of the human PAX6 gene.^ Initially, we examined the transcriptional regulation of the PAX6 gene by transient transfection assays and identified multiple cis-regulatory elements that function differently in different cell lines. The transcriptional initiation site was identified by RNase protection and primer extension assays. Examination of the genomic DNA sequence indicated that the PAX6 promoter has a TATA like-box (ATATTTT) at $-$26 bp, and two CCAAT-boxes are located at positions $-$70 and $-$100 bp. A 38 bp ply (CA) sequence was located 992 bp upstream from the initiation site. Transient transfection assays in glioblastoma cells and leukemia cells indicate that a 92 bp region was required for basal level PAX6 promoter activity. Gel retardation assays showed that this 92 bp sequence can form four DNA-protein complexes which can be specifically competed by a 31-mer oligonucleotide containing a PAX6 TATA-like sequence or an adenovirus TATA box. The activation of the promoter is positively correlated with the expression of PAX6 transcripts in cells tested.^ Based on the results obtained from the in vitro transfection assays, we did further dissection assay and functional analysis in both cell-culture and transgenic mice. We found that a 5 kb upstream promoter sequence is required for the tissue specific expression in the forebrain region which is consistent with that of the endogenous PAX6 gene. A 267 bp cell-type specific repressor located within the 5 kb fragment was identified and shown to direct forebrain specific expression. The cell-type specific repressor element has been narrowed to a 30 bp region which contains a consensus E-box by in vitro transfection assays. The third regulatory element identified was contained in a 162 bp sequence (+167 to +328) which functions as a midbrain repressor, and it appeared to be required for establishing the normal expression pattern of the PAX6 gene. Finally, a highly conserved 216 bp sequence identified in intron 4 exhibited as a spinal cord specific enhancer. And this 216 bp cis-regulatory element can be used as a marker to trace the differentiation and migration of progenitor cells in the developing spinal cord. These studies show that the concerted action of multiple cis-acting regulatory elements located upstream and downstream of the transcription initiation site determines the tissue specific expression of PAX6 gene. ^
Resumo:
Sensitive assays utilizing a cell-free and an intracellular system were employed to study the molecular bases of the DNA-damaging reactions of neocarzinostatin (NCS). In the cell-free DNA system, super-helical form I DNA from the bacteriophage PM2 was used as the substrate. The three forms of DNA present after treatment with NCS were separated by agarose gel electrophoresis. When NCS-damaged DNA was assayed under neutral conditions, there was a progressive decrease in the amount of surviving form I DNA and a corresponding increase in form II (nicked, relaxed circular) DNA, but very little increase in form III (linear duplex) DNA. This indicates that NCS introduces primarily single-strand breaks. However later studies showed that there were some site-specific double-strand breaks mediated by NCS on PM2 DNA. Seven such specific sites were mapped on the PM2 genome. When the damage was assayed under nondenaturing alkaline conditions or with the apurinic/apyrimidinic endonuclease IV, there was a slightly greater decrease in the amount of surviving form I DNA compared with neutral conditions indicating the presence of some alkali-labile sites.^ NCS-mediated DNA damage and repair were examined with cultured Chinese hamster ovary (CHO) cells using either alkaline elution for analysis of single-strand breaks or neutral elution for analysis of double-strand breaks. Most of the strand breaks introduced by NCS were capable of being rejoined. However, there was a small amount of residual DNA damage remaining unrejoined at 24-hr after removal of the drug. The amount of residual DNA damage was higher in a CHO mutant cell line (EM9) having a higher sensitivity to killing by NCS than its parental strain (AA8). Other lesions, DNA-protein complexes and alkali-labile sites, were detected after NCS treatment but they constituted only a small fraction of the DNA damage.^ Based on the above information, it can be postulated that NCS introduces some very lethal DNA damage. It is likely that the lethal lesions are a subset of the total DNA lesions representing the residual DNA damage. This DNA damage may be composed of site-specific, unrejoinable double-strand breaks and are thus the primary lesion leading to NCS-mediated lethality.^
Resumo:
Analysis of the human genome has revealed that more than 74% of human genes undergo alternative RNA splicing. Aberrations in alternative RNA splicing have been associated with several human disorders, including cancer. ^ We studied the aberrant expression of alternative RNA splicing isoforms of the Fibroblast Growth Factor Receptor 1 (FGFR1) gene in a human glioblastoma cancer model. Normal glial cells express the FGFR1α, which contains three extracellular domains. In tumors the most abundant isoform is the FGFR1β, which lacks the first extracellular domain due to the skipping of a single exon, termed alpha. The skipping of the α-exon is regulated by two intronic silencing sequences within the precursor mRNA. Since we observed no mutations on these elements in tumor cells, we hypothesized that the over-expression of regulatory proteins that recognize these sequences is responsible for the aberrant expression of splicing isoforms. Hence, we blocked the formation of protein complexes on the ISS using antisense RNA oligonucleotides in vitro. We also evaluated the impact of the ISS antisense oligonucleotides on the endogenous FGFR1 splicing, in a glioblastoma cell model. By targeting intronic regulatory elements we were able to increase the level of alpha exon inclusion up to 90% in glioblastoma cells. The effect was dose dependent, sequence specific and reproducible in glioblastoma and other cancer cells, which also exhibit an alpha exon skipping phenotype. Targeting FGFR1 endogenous ISS1 and ISS2 sequences did not have an additive or synergistic effect, which suggest a regulatory splicing mechanism that requires the interaction of complexes formed on these elements. An increase in the levels of the FGFR1α isoform resulted in a reduction in cell invasiveness. Also, a significant increase in the levels of caspase 3/7 activities, which is indicative of an elevation in apoptosis levels, suggests that expression of FGFR1β might be relevant for tumor survival. These studies demonstrate that it is possible to prevent aberrant expression of exon skipping events through the targeting of intronic regulatory elements, providing an important new therapeutic tool for the correction of human disease caused by alternative RNA splicing. ^
Resumo:
A previous study in our lab has shown that the transforming neu oncogene ($neu\sp\*$) was able to initiate signals that lead to repression of the neu promoter activity. Further deletion mapping of the neu promoter identified that the GTG element (GGTGGGGGGG), located between $-$243 and $-$234 relative to the translation initiation codon, mediates such a repression effect. I have characterized the four major protein complexes that interact with this GTG element. In situ UV-crosslinking indicated that each complex contains proteins of different molecular weights. The slowest migrating complex (S) contain Sp1 or Sp1-related proteins, as indicated by the data that both have similar molecular weights, similar properties in two affinity chromatographies, and both are antigenically related in gel shift analysis. Methylation protection and interference experiments demonstrated these complexes bind to overlapping regions of the GTG element. Mutations within the GTG element that either abrogate or enhance complex S binding conferred on the neu promoter with lower activity, indicating that positive factors other than Sp1 family proteins also contribute to neu promoter activity. A mutated version (mutant 4) of the GTG element, which binds mainly the fastest migrating complex that contains a very small protein of 26-kDa, can repress transcription when fused to a heterologous promoter. Further deletion and mutation studies suggested that this GTG mutant and its binding protein(s) may cooperate with some DNA element within a heterologous promoter to lock the basal transcription machinery; such a repressor might also repress neu transcription by interfering with the DNA binding of other transactivators. Our results suggest that both positive and negative trans-acting factors converge their binding sites on the GTG element and confer combinatorial control on the neu gene expression. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^