296 resultados para Diagnosis by PCR


Relevância:

100.00% 100.00%

Publicador:

Resumo:

O objetivo deste estudo foi aperfeiçoar um ensaio de PCR que amplificasse um fragmento de 843 pares de bases do gene p28 da Ehrlichia canis e compará-lo com outros dois métodos de PCR utilizados para amplificar partes do gene 16S rRNA e dsb do gênero Ehrlichia. Amostras sanguíneas foram colhidas de cães com diagnóstico clínico de erliquiose. A amplificação do gene p28 pela PCR produziu um fragmento de 843pb e esse ensaio permitiu a detecção do DNA de um parasita dentre 1 bilhão de células. Todas as amostras positivas detectadas pela PCR baseada no gene p28 foram também positivas pela nested PCR para detecção do gene 16S rRNA e também pela PCR dsb. Dentre as amostras negativas para a PCR p28, 55,3% foram co-negativas, mas 27,6% foram positivas pela PCR baseada nos genes 16S rRNA e dsb. A PCR p28 parece ser um teste útil para detecção molecular de E. canis, entretanto otimizações na sensibilidade nesta PCR são necessárias, para que esta técnica se torne uma importante alternativa no diagnóstico da erliquiose canina.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A pair of primers directed to 16S-23S rDNA interspacer (ITS) was designed directed to Brucella genetic sequences in order to develop a polymerase chain reaction (PCR) putatively capable of amplifying DNA from any Brucella species. Nucleic acid extracts from whole-blood from naive dogs were spiked with decreasing amounts of Brucella canis RM6/66 DNA and the resulting solutions were tested by PCR. In addition, the ability of PCR to amplify Brucella spp. genetic sequences from naturally infected dogs was evaluated using 210 whole-blood samples of dogs from 19 kennels. The whole-blood samples collected were subjected to blood culture and PCR. Serodiagnosis was performed using the rapid slide agglutination test with and without 2-mercaptoethanol. The DNA from whole blood was extracted using proteinase-K, sodium dodecyl sulphate and cetyl trimethyl ammonium bromide followed by phenol-chloroform purification. The PCR was capable of detecting as little as 3.8 fg of Brucella DNA mixed with 450 ng of host DNA. Theoretically, 3.8 fg of Brucella DNA represents the total genomic mass of fewer than two bacterial cells. The PCR diagnostic sensitivity and specificity were 100%. From the results observed in the present study, we conclude that PCR could be used as confirmatory test for diagnosis of B. canis infection.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Aiming to improve the diagnosis of canine leishmaniasis (CanL) in an endemic area of the Northwest region of São Paulo State, Brazil, the efficacy of parasitological, immunological and molecular diagnostic methods were studied. Dogs with and without clinical sips of the disease and positive for Leishmania, by direct parasite identification on lymph node smears and/or specific antibody detection by ELISA, were selected for the study. According to the clinical signs, 89 dogs attending the Veterinary Hospital of UNESP in Aracatuba (SP, Brazil) were divided into three groups: symptomatic (36%), oligosymptomatic (22%) and asymptomatic (22%). Twenty-six dogs from an area non-endemic for CanL were used as negative controls (20%). Fine-needle aspiration biopsies (FNA) of popliteal lymph nodes were collected and Diff-Quick (R)-stained for optical microscopy. Direct immumofluorescence, immunocytochemistry and parasite DNA amplification by PCR were also performed. After euthanasia, fragments of popliteal lymph nodes, spleen, bone marrow and liver were collected and processed for HE and immunohistochemistry. Parasite detection by both HE and immunohistochemistry was specifically more effective in lymph nodes, when compared with the other organs. Immunolabeling provided higher sensitivity for parasite detection in the tissues. In the symptomatic group, assay sensitivity was 75.61% for direct parasite search on Diff-Quick (R)-stained FNAs, 92.68% for direct immunofluorescence, 92.68% for immunocytochemistry and 100% for PCR; the corresponding values in the other clinical groups were: 32, 60, 76 and 96% (oligosymptomatic), and 39.13, 73.91, 100 and 95.65% (asymptomatic). Results of the control animals from the CanL non-endemic area were all negative, indicating that the methods used were 100% specific. (C) 2006 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

More sensitive methodologies are necessary to improve strongyloidiasis diagnosis. This study compared the sensitivities of the McMaster modified technique and polymerase chain reaction (PCR) assays, both performed in faecal samples. Lewis rats were subcutaneously infected with 4,000, 400 or 40 infective third-stage larvae, considered as high, moderate or low infection, respectively. Seven days later, they were euthanized to count adult nematodes recovered from the small intestine. Stool samples were used to count the number of eggs per gram (EPG) of faeces and to detect parasite DNA by PCR performed with a species and a genus primer pair. The sensitivity of these assays depended upon parasite burden and the primer specificity. All assays presented 100% sensitivity at the highest parasite load. In the moderate infection, EPG and PCR with the genus primer maintained 100% specificity, whereas PCR sensitivity with the species primer decreased to 77.7%. In low infection, the sensitivity was 60% for EPG, 0% for PCR with the species primer and 90% for PCR done with the genus primer. Together, these results suggest that PCR with a genus primer can be a very sensitive methodology to detect Strongyloides venezuelensisin faeces of Lewis rats infected with very low parasite burden.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A Nested-PCR (N-PCR) tem como objetivo melhorar a sensibilidade do diagnóstico direto da Pneumonia Enzoótica Suína, pois o isolamento do Mycoplasma hyopneumoniae é trabalhoso tornando-se inviável na rotina. Neste trabalho, foi realizado um projeto piloto para a otimização da técnica de N-PCR, utilizando três variáveis: tipo de amostra biológica, meio de transporte da amostra e método de extração do DNA, utilizando oito animais. Os resultados obtidos foram empregados no segundo experimento para a validação do teste utilizando 40 animais. Os resultados obtidos, pela otimização da N-PCR, neste trabalho, permite sugerir esta prova como método de diagnóstico de rotina no monitoramento das infecções por Mycoplasma hyopneumoniae em granjas de suínos.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to compare the different methods of detecting Toxoplasma gondii in sheep tissue, tested serologically positive by the indirect immunofluorescent antibody test (IFAT). Brain, diaphragm, and blood samples were collected from 522 sheep slaughtered at the São Manuel abattoir, São Paulo State, Brazil. Brain and diaphragm samples from IFAT seropositive animals were digested by both trypsin and pepsin and then injected into mice. Part of the digested samples was used to prepare slides for Giemsa staining and in the polymerase chain reaction (PCR). Tissue fragments were fixed in formalin and examined using hematoxilin-eosin (HE). Forty of the sheep (7.7%) were IFAT positive. T. gondii was isolated in 23 (59.0%) of the 39 mice with pepsin-digested brain samples and in 27 (69.0%) of the 39 with trypsin-digested brain samples. Injection of diaphragm samples led to T. gondii isolation in 26 (66.7%) of the 39 pepsin-digested samples and 21 (53.8%) of the 39 trypsin-digested samples. Cytological and hystopathological examination of both brains and diaphragms was negative in all examined sheep. PCR was positive in 7 (17.9%) of the trypsin and 2 (5.1%) of the pepsin-digested samples, while 9 (23.1%) of the trypsin and 3 (7.7%) of the pepsin-digested samples showed T. gondii DNA. T. gondii isolation rate in mice (n = 34; 85.0%) was significantly higher than detection by PCR (n = 15; 37.5%). © 2001 Elsevier Science B.V.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)