Algorithmic computation of knot polynomials of secondary structure elements of proteins

The classification of protein structures is an important and still outstanding problem. The purpose of this paper is threefold. First, we utilize a relation between the Tutte and homfly polynomial to show that the Alexander-Conway polynomial can be algorithmically computed for a given planar graph. Second, as special cases of planar graphs, we use polymer graphs of protein structures. More precisely, we use three building blocks of the three-dimensional protein structure-alpha-helix, antiparallel beta-sheet, and parallel beta-sheet-and calculate, for their corresponding polymer graphs, the Tutte polynomials analytically by providing recurrence equations for all three secondary structure elements. Third, we present numerical results comparing the results from our analytical calculations with the numerical results of our algorithm-not only to test consistency, but also to demonstrate that all assigned polynomials are unique labels of the secondary structure elements. This paves the way for an automatic classification of protein structures.

Structure-activity studies on position 14 of human alpha-calcitonin gene-related peptide

A structure-activity study was performed to examine the role of position 14 of human alpha-calcitonin gene-related peptide (h-alpha-CGRP) in activating the CGRP receptor. Interestingly, position 14 of h-alpha-CGRP contains a glycyl residue and is part of an alpha-helix spanning residues 8-18. Analogues [Ala(14)]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, [Asn(14)]-h-alpha-CGRP, and [Pro(14)]-h-alpha-CGRP were synthesized by solid phase peptide methodology and purified by RP-HPLC. Secondary structure was measured by circular dichroism spectroscopy. Agonist activities were determined as the analogues' ability to stimulate amylase secretion from guinea pig pancreatic acini and to relax precontracted porcine coronary arteries. Analogues [Ala(1)4]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, and [Asn(14)]-h-alpha-CGRP, all containing residues with a high helical propensity in position 14, were potent full agonists compared to h-alpha-CGRP in both tissues. Interestingly, replacement of Gly(14) of h-alpha-CGRP with these residues did not substantially increase the helical content of these analogues. [Pro(14)]-h-alpha-CGRP, predictably, has significantly lower helical content and is a 20-fold less potent agonist on coronary artery, known to contain CGRP-1 receptor subtypes, and an antagonist on pancreatic acini, known to contain CGRP-2 receptor subtypes. In conclusion, the residue in position 14 plays a structural role in stabilizing the alpha-helix spanning residues 8-18. The alpha-helix is crucial for maintaining highly potent agonist effects of h-alpha-CGRP at CGRP receptors. The wide variety of functional groups that can be tolerated in position 14 with no substantial modification of agonist effects suggests the residue in this position is not in contact with the CGRP receptor. [Pro(14)]-h-alpha-CGRP may be a useful pharmacological tool to distinguish between CGRP-1 and CGRP-2 receptor subtypes.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DPP IV resistance and insulin releasing activity of a novel di-substituted analogue of glucose-dependent insulinotropic polypeptide, (Ser(2)-Asp(13))GIP

Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P

Influence of alpha-helicity, amphipathicity and D-amino acid incorporation on the peptide-induced mast cell activation

Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.

Functional analysis of the C-terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in Salmonella enterica

WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.

FLT1 Genetic Variation Predisposes to Neovascular AMD in Ethnically Diverse Populations and Alters Systemic FLT1 Expression

Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.

Probing the Unfolded Configurations of a β-Hairpin Using Sketch-Map

This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.

Hybrid Diphenylalkyne-Dipeptide Oligomers Induce Multistrand β-Sheet Formation

Functionalized diphenylalkynes provide a template for the presentation of protein-like surfaces composed of multistrand β-sheets. The conformational properties of three-, four-, and seven-stranded systems have been investigated in the solid- and solution-state. This class of molecule may be suitable for the mediation of therapeutically relevant protein-protein interactions.

β-Strand mimetic foldamers rigidified through dipolar repulsion

Many therapeutically relevant protein-protein interactions contain hot-spot regions on secondary structural elements, which contribute disproportionately to binding enthalpy. Mimicry of such α-helical regions has met with considerable success, however the analogous approach for the β-strand has received less attention. Presented herein is a foldamer for strand mimicry in which dipolar repulsion is a central determinant of conformation. Computation as well as solution- and solid-phase data are consistent with an ensemble weighted almost exclusively in favor of the desired conformation.

The Industrial Context of Occupational Mobility: Change in Structure

The neglect of a consideration of history has been a feature of mobility research. ‘History’ affects the results of analyses of social mobility by altering the occupational/industrial structure and by encouraging exchange mobility. Changes in industrial structure are rooted more directly in historical causes and can be seen as more fundamental than changes in occupational structure. Following a substantial review of the secondary literature on changes in industrial and occupational structure in Northern Ireland, loglinear analyses of intra- and intergenerational mobility tables for sociologically-derived cohort generations that incorporate occupational and industrial categories are presented. Structural and inheritance effects for industry are as significant as those for occupation. Given the well-established finding of ‘constant social fludity’ in mobility tables once structural effects are controlled, the inclusion of categorization by industry is necessary in order to reach an accurate understanding of occupational mobility and the role of historical change in mobility.

Design optimisation of ring elements for broadband reflectarray antennas

Plane wave scattering from a flat surface consisting of two periodic arrays of ring elements printed on a grounded dielectric sheet is investigated. It is shown that the reflection phase variation as a function of ring diameter is controlled by the difference in the centre resonant frequency of the two arrays. Simulated and measured results at X-band demonstrate that this parameter can be used to reduce the gradient and improve the linearity of the reflection phase versus ring size slope. These are necessary conditions for the re-radiating elements to maximise the bandwidth of a microstrip reflectarray antenna. The scattering properties of a conventional dual resonant multilayer structure and an array of concentric rings printed on a metal backed dielectric substrate are compared and the trade-off in performance is discussed.

Effect of relaxation on the oxygen K-edge electron energy-loss near-edge structure in yttria-stabilized zirconia

The electron energy-loss near-edge structure (ELNES) at the oxygen K-edge has been investigated in a range of yttria-stabilized zirconia (YSZ) materials. The electronic structure of the three polymorphs of pure ZrO2 and of the doped YSZ structure close to the 33 mol %Y2O3 composition have been calculated using a full-potential linear muffin-tin orbital method (NFP-LMTO) as well as a pseudopotential based technique. Calculations of the ELNES dipole transition matrix elements in the framework of the NFP-LMTO scheme and inclusion of core hole screening within Slater's transition state theory enable the ELNES to be computed. Good agreement between the experimental and calculated ELNES is obtained for pure monoclinic ZrO2. The agreement is less good with the ideal tetragonal and cubic structures. This is because the inclusion of defects is essential in the calculation of the YSZ ELNES. If the model used contains ordered defects such as vacancies and metal Y planes, agreement between the calculated and experimental O K-edges is significantly improved. The calculations show how the five different O environments of Zr,Y,O, are connected with the features observed in the experimental spectra and demonstrate clearly the power of using ELNES to probe the stabilization mechanism in doped metal oxides.

Doppler cooling of gallium atoms: 1. Fine structure effects and transient coherences

A realistic model of the dipole radiation forces in transverse Doppler cooling (with a s+-s- laser configuration) of an atomic beam of group 13 elements is studied within the quantum-kinetic equation framework. The full energy level sub-structure for such an atom with I = 0 (such as 66Ga) is analysed. Two cooling strategies are investigated; the first involving the 2P3/2 ? 2D5/2 transition and the second a dual laser cooling experiment involving transitions 2P1/2 and 2P3/2 ? 2S1/2. The latter scheme creates a velocity-independent dark-state resonance that inhibits a steady-state dipole cooling force. However, time-dependent calculations show that transient cooling forces are present that could be exploited for laser cooling purposes in pulsed laser fields.