Algorithmic computation of knot polynomials of secondary structure elements of proteins

The classification of protein structures is an important and still outstanding problem. The purpose of this paper is threefold. First, we utilize a relation between the Tutte and homfly polynomial to show that the Alexander-Conway polynomial can be algorithmically computed for a given planar graph. Second, as special cases of planar graphs, we use polymer graphs of protein structures. More precisely, we use three building blocks of the three-dimensional protein structure-alpha-helix, antiparallel beta-sheet, and parallel beta-sheet-and calculate, for their corresponding polymer graphs, the Tutte polynomials analytically by providing recurrence equations for all three secondary structure elements. Third, we present numerical results comparing the results from our analytical calculations with the numerical results of our algorithm-not only to test consistency, but also to demonstrate that all assigned polynomials are unique labels of the secondary structure elements. This paves the way for an automatic classification of protein structures.

Structure-activity studies on position 14 of human alpha-calcitonin gene-related peptide

A structure-activity study was performed to examine the role of position 14 of human alpha-calcitonin gene-related peptide (h-alpha-CGRP) in activating the CGRP receptor. Interestingly, position 14 of h-alpha-CGRP contains a glycyl residue and is part of an alpha-helix spanning residues 8-18. Analogues [Ala(14)]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, [Asn(14)]-h-alpha-CGRP, and [Pro(14)]-h-alpha-CGRP were synthesized by solid phase peptide methodology and purified by RP-HPLC. Secondary structure was measured by circular dichroism spectroscopy. Agonist activities were determined as the analogues' ability to stimulate amylase secretion from guinea pig pancreatic acini and to relax precontracted porcine coronary arteries. Analogues [Ala(1)4]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, and [Asn(14)]-h-alpha-CGRP, all containing residues with a high helical propensity in position 14, were potent full agonists compared to h-alpha-CGRP in both tissues. Interestingly, replacement of Gly(14) of h-alpha-CGRP with these residues did not substantially increase the helical content of these analogues. [Pro(14)]-h-alpha-CGRP, predictably, has significantly lower helical content and is a 20-fold less potent agonist on coronary artery, known to contain CGRP-1 receptor subtypes, and an antagonist on pancreatic acini, known to contain CGRP-2 receptor subtypes. In conclusion, the residue in position 14 plays a structural role in stabilizing the alpha-helix spanning residues 8-18. The alpha-helix is crucial for maintaining highly potent agonist effects of h-alpha-CGRP at CGRP receptors. The wide variety of functional groups that can be tolerated in position 14 with no substantial modification of agonist effects suggests the residue in this position is not in contact with the CGRP receptor. [Pro(14)]-h-alpha-CGRP may be a useful pharmacological tool to distinguish between CGRP-1 and CGRP-2 receptor subtypes.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DPP IV resistance and insulin releasing activity of a novel di-substituted analogue of glucose-dependent insulinotropic polypeptide, (Ser(2)-Asp(13))GIP

Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P

Influence of alpha-helicity, amphipathicity and D-amino acid incorporation on the peptide-induced mast cell activation

Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.

Functional analysis of the C-terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in Salmonella enterica

WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.

FLT1 Genetic Variation Predisposes to Neovascular AMD in Ethnically Diverse Populations and Alters Systemic FLT1 Expression

Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.

Probing the Unfolded Configurations of a β-Hairpin Using Sketch-Map

This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.

Hybrid Diphenylalkyne-Dipeptide Oligomers Induce Multistrand β-Sheet Formation

Functionalized diphenylalkynes provide a template for the presentation of protein-like surfaces composed of multistrand β-sheets. The conformational properties of three-, four-, and seven-stranded systems have been investigated in the solid- and solution-state. This class of molecule may be suitable for the mediation of therapeutically relevant protein-protein interactions.

z'-band Ground-based Detection of the Secondary Eclipse of WASP-19b

We present the ground-based detection of the secondary eclipse of the transiting exoplanet WASP-19b. The observations were made in the Sloan z' band using the ULTRACAM triple-beam CCD camera mounted on the New Technology Telescope. The measurement shows a 0.088% ± 0.019% eclipse depth, matching previous predictions based on H- and K-band measurements. We discuss in detail our approach to the removal of errors arising due to systematics in the data set, in addition to fitting a model transit to our data. This fit returns an eclipse center, T 0, of 2455578.7676 HJD, consistent with a circular orbit. Our measurement of the secondary eclipse depth is also compared to model atmospheres of WASP-19b and is found to be consistent with previous measurements at longer wavelengths for the model atmospheres we investigated.

Probable z'-band Ground-based Detection of the Secondary Eclipse of WASP-19b

We present the probable ground-based detection of the secondary eclipse of the transiting exoplanet WASP-19b. The observations were made in the Sloan z'-band using the ULTRACAM triple-beam CCD camera mounted on the NTT. The measurement shows a 1±0.2mmag eclipse depth, consistent with a dayside temperature of 2900K, matching previous predictions based on H- and K-band measurements. However, since this is based on a single observation, the eclipse depth - at the moment - is not particularly well constrained, and would benefit from additional observations at similar wavelengths. Our technique for the data reduction and analysis is described, along with our approach to dealing with systematic errors associated with ground-based secondary eclipse observations.

The internal structure of asteroid (25143) Itokawa as revealed by detection of YORP spin-up *’**

Context. Near-Earth asteroid (25143) Itokawa was visited by the Hayabusa spacecraft in 2005, resulting in a highly detailed shape and surface topography model. This model has led to several predictions for the expected radiative torques on this asteroid, suggesting that its spin rate should be decelerating. Aims. To detect changes in rotation rate that may be due to YORP-induced radiative torques, which in turn may be used to investigate the interior structure of the asteroid. Methods. Through an observational survey spanning 2001 to 2013 we obtained rotational lightcurve data at various times over the last five close Earth-approaches of the asteroid. We applied a polyhedron-shape-modelling technique to assess the spin-state of the asteroid and its long term evolution. We also applied a detailed thermophysical analysis to the shape model determined from the Hayabusa spacecraft. Results. We have successfully measured an acceleration in Itokawa's spin rate of dω/dt = (3.54 ± 0.38) × 10 rad day, equivalent to a decrease of its rotation period of ~45 ms year. From the thermophysical analysis we find that the centre-of-mass for Itokawa must be shifted by ~21 m along the long-axis of the asteroid to reconcile the observed YORP strength with theory. Conclusions. This can be explained if Itokawa is composed of two separate bodies with very different bulk densities of 1750 ± 110 kg m and 2850 ± 500 kg m, and was formed from the merger of two separate bodies, either in the aftermath of a catastrophic disruption of a larger differentiated body, or from the collapse of a binary system. We therefore demonstrate that an observational measurement of radiative torques, when combined with a detailed shape model, can provide insight into the interior structure of an asteroid. Futhermore, this is the first measurement of density inhomogeneity within an asteroidal body, that reveals significant internal structure variation. A specialised spacecraft is normally required for this.

Direct Detection of YORP Spin-up on Asteroid (25143) Itokawa and Implications for its Internal Structure

Near-Earth asteroid (25143) Itokawa was visited by the Hayabusa spacecraft in 2005, resulting in a highly detailed surface shape and topography model. This model has led to several predictions for the expected radiative torques on this asteroid, suggesting that its spin rate should be decelerating. Through an observational survey spanning 2001 to 2013 we have successfully measured an acceleration in its spin rate of dω/dt = 3.54 (± 0.38) × 10^(-8) rad day^(-2), equivalent to a decrease of its rotation period of ~ 45 ms year^(-1). Using the shape model determined from the Hayabusa spacecraft, we applied a detailed thermophysical analysis, to reconcile the predicted YORP strength with that observed. We find that the center-of-mass for Itokawa must be shifted by ~20 m along the long-axis of the asteroid to reconcile observations with theory. This can be explained if Itokawa is composed of two separate bodies with very different bulk densities of 1740 ± 110 kg m^(-3) and 2730 ± 440 kg m^(-3), and was formed from the merger of two separate bodies, consistent with the collapse of a binary system or the re-accumulation of material from a catastrophic collisional disruption. We demonstrate that an observational measurement of radiative torques, when combined with a detailed shape model, can provide insight into the interior structure of an asteroid.

Seismic damage detection for a steel braced frame structure

A new approach for global detection of seismic damage in a single-storey steel concentrically braced frame (CBF) structure is presented. The filtered lateral in-plane acceleration response of the CBF structure is integrated twice to provide the lateral in-plane displacement which is used to infer buckling and yielding damage. The level of interstorey drift of the CBF during a seismic excitation allows the yield and buckling of the bracing members to be identified and indirectly detects damage based on exceedance of calculated lateral in-plane displacement limits. A band-pass filter removes noise from the acceleration signal followed by baseline correction being used to reduce the drift in velocity and displacement during numerical integration. This pre-processing results in reliable numerical integration of the frame acceleration that predicts the displacement response accurately when compared to the measured lateral displacement of the CBF structure. Importantly, the structural damage is not assumed through removal of bracing members, rather damage is induced through actual seismic loading. The buckling and yielding displacement threshold limits used to identify damage are demonstrated to accurately identify the initiation of buckling and yielding.