16 resultados para Secondary Structure
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
The classification of protein structures is an important and still outstanding problem. The purpose of this paper is threefold. First, we utilize a relation between the Tutte and homfly polynomial to show that the Alexander-Conway polynomial can be algorithmically computed for a given planar graph. Second, as special cases of planar graphs, we use polymer graphs of protein structures. More precisely, we use three building blocks of the three-dimensional protein structure-alpha-helix, antiparallel beta-sheet, and parallel beta-sheet-and calculate, for their corresponding polymer graphs, the Tutte polynomials analytically by providing recurrence equations for all three secondary structure elements. Third, we present numerical results comparing the results from our analytical calculations with the numerical results of our algorithm-not only to test consistency, but also to demonstrate that all assigned polynomials are unique labels of the secondary structure elements. This paves the way for an automatic classification of protein structures.
Resumo:
A structure-activity study was performed to examine the role of position 14 of human alpha-calcitonin gene-related peptide (h-alpha-CGRP) in activating the CGRP receptor. Interestingly, position 14 of h-alpha-CGRP contains a glycyl residue and is part of an alpha-helix spanning residues 8-18. Analogues [Ala(14)]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, [Asn(14)]-h-alpha-CGRP, and [Pro(14)]-h-alpha-CGRP were synthesized by solid phase peptide methodology and purified by RP-HPLC. Secondary structure was measured by circular dichroism spectroscopy. Agonist activities were determined as the analogues' ability to stimulate amylase secretion from guinea pig pancreatic acini and to relax precontracted porcine coronary arteries. Analogues [Ala(1)4]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, and [Asn(14)]-h-alpha-CGRP, all containing residues with a high helical propensity in position 14, were potent full agonists compared to h-alpha-CGRP in both tissues. Interestingly, replacement of Gly(14) of h-alpha-CGRP with these residues did not substantially increase the helical content of these analogues. [Pro(14)]-h-alpha-CGRP, predictably, has significantly lower helical content and is a 20-fold less potent agonist on coronary artery, known to contain CGRP-1 receptor subtypes, and an antagonist on pancreatic acini, known to contain CGRP-2 receptor subtypes. In conclusion, the residue in position 14 plays a structural role in stabilizing the alpha-helix spanning residues 8-18. The alpha-helix is crucial for maintaining highly potent agonist effects of h-alpha-CGRP at CGRP receptors. The wide variety of functional groups that can be tolerated in position 14 with no substantial modification of agonist effects suggests the residue in this position is not in contact with the CGRP receptor. [Pro(14)]-h-alpha-CGRP may be a useful pharmacological tool to distinguish between CGRP-1 and CGRP-2 receptor subtypes.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P
Resumo:
Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.
Resumo:
WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.
Resumo:
Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.
Resumo:
This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.
Resumo:
Functionalized diphenylalkynes provide a template for the presentation of protein-like surfaces composed of multistrand β-sheets. The conformational properties of three-, four-, and seven-stranded systems have been investigated in the solid- and solution-state. This class of molecule may be suitable for the mediation of therapeutically relevant protein-protein interactions.
Resumo:
The neglect of a consideration of history has been a feature of mobility research. ‘History’ affects the results of analyses of social mobility by altering the occupational/industrial structure and by encouraging exchange mobility. Changes in industrial structure are rooted more directly in historical causes and can be seen as more fundamental than changes in occupational structure. Following a substantial review of the secondary literature on changes in industrial and occupational structure in Northern Ireland, loglinear analyses of intra- and intergenerational mobility tables for sociologically-derived cohort generations that incorporate occupational and industrial categories are presented. Structural and inheritance effects for industry are as significant as those for occupation. Given the well-established finding of ‘constant social fludity’ in mobility tables once structural effects are controlled, the inclusion of categorization by industry is necessary in order to reach an accurate understanding of occupational mobility and the role of historical change in mobility.
Resumo:
The phylogeographical structure of brown trout Salmo trutta in Britain and Ireland was studied using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of four mitochondrial DNA segments (16S/ND1, ND5/6, COXIII/ND5 and ND5/12S). Analysis of 3636 individuals from 83 sites-morphotypes revealed a total of 25 haplotypes. These haplotypes were nested in seven two-step clades. Although there was a clear geographical patterning to the occurrence of derived clades, admixture among ancestral clades was extensive throughout the studied area. A relevant feature of the data was that some populations contained mixtures of highly divergent clades. This type II phylogeographic pattern is uncommon in nature. Clade intermixing is likely to have taken place during earlier interglacials as well as since the Last Glacial Maximum. The anadromous life history of many S. trutta populations has probably also contributed to clade mixing. Based on the data presented here and published data, postglacial colonization of Britain and Ireland most likely involved S. trutta from at least five potential glacial refuges. Probable locations for such refugia were: south of England-western France, east of the Baltic Sea, western Ireland, Celtic Sea and North Sea. Ferox S. trutta, as defined by their longevity, late maturation and piscivory, exhibited a strong association with a particular clade indicating that they share a common ancestor. Current evidence indicates that the Lough Melvin gillaroo S. trutta and sonaghen S. trutta sympatric types diverged prior to colonization of Lough Melvin and, although limited gene flow has occurred since secondary contact, they have remained largely reproductively isolated due to inlet and outlet river spawning segregation. Gillaroo S. trutta may reflect descendents of a previously more widespread lineage that has declined due to habitat alterations particularly affecting outlet rivers. The mosaic-like distribution of mtDNA lineages means that conservation prioritization in Britain and Ireland should be based on the biological characteristics of local populations rather than solely on evolutionary lineages.
Resumo:
Base rate neglect on the mammography problem can be overcome by explicitly presenting a causal basis for the typically vague false-positive statistic. One account of this causal facilitation effect is that people make probabilistic judgements over intuitive causal models parameterized with the evidence in the problem. Poorly defined or difficult-to-map evidence interferes with this process, leading to errors in statistical reasoning. To assess whether the construction of parameterized causal representations is an intuitive or deliberative process, in Experiment 1 we combined a secondary load paradigm with manipulations of the presence or absence of an alternative cause in typical statistical reasoning problems. We found limited effects of a secondary load, no evidence that information about an alternative cause improves statistical reasoning, but some evidence that it reduces base rate neglect errors. In Experiments 2 and 3 where we did not impose a load, we observed causal facilitation effects. The amount of Bayesian responding in the causal conditions was impervious to the presence of a load (Experiment 1) and to the precise statistical information that was presented (Experiment 3). However, we found less Bayesian responding in the causal condition than previously reported. We conclude with a discussion of the implications of our findings and the suggestion that there may be population effects in the accuracy of statistical reasoning.
Resumo:
The BAR (Bin/amphiphysin/Rvs) domain is the most conserved feature in amphiphysins from yeast to human and is also found in endophilins and nadrins. We solved the structure of the Drosophila amphiphysin BAR domain. It is a crescent-shaped dimer that binds preferentially to highly curved negatively charged membranes. With its N-terminal amphipathic helix and BAR domain (N-BAR), amphiphysin can drive membrane curvature in vitro and in vivo. The structure is similar to that of arfaptin2, which we find also binds and tubulates membranes. From this, we predict that BAR domains are in many protein families, including sorting nexins, centaurins, and oligophrenins. The universal and minimal BAR domain is a dimerization, membrane-binding, and curvature-sensing module.
Resumo:
Stream bed metal deposits affect the taxon richness, density and taxonomic diversity of primary and secondary producers by a variety of direct or indirect abiotic and biotic processes but little is known about the relative importance of these processes over a deposit metal concentration gradient. Inorganic matter (IM), algal and non-photosynthetic detrital (NPD) dry biomasses were estimated for 10 monthly samples, between 2007 and 2008, from eight sites differing in deposit density. Invertebrate abundance, taxon richness and composition were also determined. Relations between these variables were investigated by canonical correspondence analysis (CCA), generalized estimating equation models and path analysis. The first CCA axis correlates with deposit density and invertebrate abundance, with lumbriculids and chironomids increasing in abundance with deposit density and all other taxa declining. Community structure changes significantly above a deposit density of approximately 8 mg cm, when algal biomass, invertebrate richness and diversity decline. Invertebrate richness and diversity were determined by direct effects of NPD biomass and indirect effects of IM. Algal biomass only had an effect on invertebrate abundance. Possible pH, oxygen, food and ecotoxicological effects of NPD biomass on the biota are discussed.