11 resultados para Schiff base complexes
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
Second-generation carnosine analogs bearing the histidyl-hydrazide moiety have been synthesized and tested for their efficiency in scavenging malondialdehyde (MDA) derived from lipid peroxidation and for their ability to reverse the glycation process in the glucose-ethylamine Schiff base model. The data obtained indicate that this class of compounds maintains the activity profile of carnosine and is a suitable candidate for the treatment of disorders caused by oxidative stress.
Resumo:
The synthesis of a new bis(2,2-bipyridine), bridged by a Schiff base cyclohexane moiety is described. Surprisingly, this compound does not appear to form discrete oligonuclear metal complexes on the addition of zinc(II) and iron(II) cations. In order to rationalise this behaviour, the compound's conformation has been explored using a combination of circular dichroism, X-ray crystallography and DFT calculations, indicating that at least two energy barriers need to be overcome to orientate the ligand in a suitable conformation to permit the formation of coordination helicates with control over the metal centred stereochemistry. (C) 2004 Elsevier Ltd. All rights reserved.
Resumo:
Lanthanide-containing liquid crystals exhibiting a mesophase close to room temperature were obtained by adduct formation between a long-chain salicylaldimine Schiff base and tris(2-thenoyltrifluoroacetonato)lanthanide( III) complexes or tris( benzoyltrifluoroacetonato) lanthanide( III) complexes. The mesophase was identified as a smectic A phase. The temperature range of the mesophase was found to decrease over the lanthanide series, and no mesophase was observed for the complexes of the smallest lanthanide ions. The photoluminescence of the europium( III), samarium( III), neodymium( III), and erbium( III) complexes was studied. It is shown that the clearing point can be detected by monitoring the luminescence decay time as a function of the temperature.
Resumo:
The title compound, [Ni2Cl2(C9H10NO2)(2)]center dot CH3OH, is a dinuclear unit built up by two nickel(II) complexes, bridged by two Cl atoms. The coordination geometry around each Ni-II atom can be considered as distorted square-pyramidal, with the tridendate chelate Schiff base ligands coordinating in a trans conformation through their imine N atom and phenoxy and alkoxy O atoms.
Resumo:
Malondialdehyde (MDA) and 4-hydroxynonenal (HNE) are major end-products of oxidation of polyunsaturated fatty acids, and are frequently measured as indicators of lipid peroxidation and oxidative stress in vivo. MDA forms Schiff-base adducts with lysine residues and cross-links proteins in vitro; HNE also reacts with lysines, primarily via a Michael addition reaction. We have developed methods using NaBH4 reduction to stabilize these adducts to conditions used for acid hydrolysis of protein, and have prepared reduced forms of lysine-MDA [3-(N epsilon-lysino)propan-1-ol (LM)], the lysine-MDA-lysine iminopropene cross-link [1,3-di(N epsilon-lysino)propane (LML)] and lysine-HNE [3-(N epsilon-lysino)-4-hydroxynonan-l-ol (LHNE)]. Gas chromatography/MS assays have been developed for quantification of the reduced compounds in protein. RNase incubated with MDA or HNE was used as a model for quantification of the adducts by gas chromatography/MS. There was excellent agreement between measurement of MDA bound to RNase as LM and LML, and as thiobarbituric acid-MDA adducts measured by HPLC; these adducts accounted for 70-80% of total lysine loss during the reaction with MDA. LM and LML (0.002-0.12 mmol/ mol of lysine) were also found in freshly isolated low-density lipoprotein (LDL) from healthy subjects. LHNE was measured in RNase treated with HNE, but was not detectable in native LDL. LM, LML and LHNE increased in concert with the formation of conjugated dienes during the copper-catalysed oxidation of LDL, but accounted for modification of <1% of lysine residues in oxidized LDL. These results are the first report of direct chemical measurement of MDA and HNE adducts to lysine residues in LDL. LM, LML and LHNE should be useful as biomarkers of lipid peroxidative modification of protein and of oxidative stress in vitro and in vivo.
Resumo:
Oxidative stress is implicated in the pathogenesis of numerous disease processes including diabetes mellitus, atherosclerosis, ischaemia reperfusion injury and rheumatoid arthritis. Chemical modification of amino acids in protein during lipid peroxidation results in the formation of lipoxidation products which may serve as indicators of oxidative stress in vivo. The focus of the studies described here was initially to identify chemical modifications of protein derived exclusively from lipids in order to assess the role of lipid peroxidative damage in the pathogenesis of disease. Malondialdehye (MDA) and 4-hydroxynonenal (HNE) are well characterized oxidation products of polyunsaturated fatty acids on low-density lipoprotein (LDL) and adducts of these compounds have been detected by immunological means in atherosclerotic plaque. Thus, we first developed gas chromatography-mass spectrometry assays for the Schiff base adduct of MDA to lysine, the lysine-MDA-lysine diimine cross-link and the Michael addition product of HNE to lysine. Using these assays, we showed that the concentrations of all three compounds increased significantly in LDL during metal-catalysed oxidation in vitro. The concentration of the advanced glycation end-product N epsilon-(carboxymethyl)lysine (CML) also increased during LDL oxidation, while that of its putative carbohydrate precursor the Amadori compound N epsilon-(1-deoxyfructose-1-yl)lysine did not change, demonstrating that CML is a marker of both glycoxidation and lipoxidation reactions. These results suggest that MDA and HNE adducts to lysine residues should serve as biomarkers of lipid modification resulting from lipid peroxidation reactions, while CML may serve as a biomarker of general oxidative stress resulting from both carbohydrate and lipid oxidation reactions.
Resumo:
Piano stool complexes of rhodium and iridium activated by fluorinated and non-fluorinated N-heterocyclic carbene (NHC) ligands were shown to be catalysts for racemization in the one-pot chemoenzymic dynamic kinetic resolution (DKR) of secondary alcohols. Excellent conversions and good enantioselectivities were observed for alkyl aryl and dialkyl secondary alcohols.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The review provides insight into the mechanism of ligand substitution and electron transfer (from chromium(III) to iron(III)) by comparison of the reactivity of some tetraazamacrocyclic chromium(III) complexes in the conjugate acid-base forms. Use of two geometrical isomers made possible to estimate the influence of geometry and protolytic reactions in trans and cis position towards the leaving group on the rate enhancement. Studies on the reaction rates in different media demonstrated the role played by outer sphere interactions in a monodentate ligand substitution. (C) 2009 Published by Elsevier B.V.
Resumo:
A ditopic ligand (1), containing two tridentate bis(acylhydrazone) subunits and bearing both long alkyl chains and hydrogen-bonding groups, has been synthesised. Metal cation binding in the presence of a base leads to hierarchical self-assembly, forming first a neutral [2 x 2] grid-type complex (2) that hierarchically assembles into metallosupramolecular polymer gels in toluene.
Resumo:
Liquid coordination complexes (LCCs) are a new class of liquid Lewis acids, prepared by combining an excess of a metal halide (e.g. GaCl3) with a basic donor molecule (e.g. amides, amines or phosphines). LCCs were used to catalyse oligomerisation of 1-decene to polyalphaolefins (PAOs). Molecular weight distribution and physical properties of the produced oils were compliant with those required for low viscosity synthetic (Group IV) lubricant base oils. Kinematic viscosities at 100 °C of ca. 4 or 6 cSt were obtained, along with viscosity indexes above 120 and pour points below −57 °C. In industry, to achieve similar properties, BF3 gas is used as a catalyst. LCCs are proposed as a safer and economically attractive alternative to BF3 gas for the production of polyalphaolefins.